Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114991 Similarity: 0.992 Similarity: 0.991 Similarity: 0.991
UTR: 5HSAA114991
Gene: TTYH2
MFE: -9.450
ENS: 0.805
Length: 42.
Predicted Ligands:
preQ_1 - 17/20
SAM - 2/20
Mg2+ - 1/20
 RS: URS0000C268B6_157838
MFE: -9.601
Ligand: preQ_1
Species: Bacillus shackletonii PreQ1 riboswitch
 RS: URS0000C25FF0_1476857
MFE: -8.448
Ligand: preQ_1
Species: Bacillus sp. B-jedd PreQ1 riboswitch
 RS: URS0000AB3019_665959
MFE: -8.448
Ligand: preQ_1
Species: Bacillus sp. 2_A_57_CT2 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114991 URS0000C268B6_157838 URS0000C25FF0_1476857 URS0000AB3019_665959
Length 42. 43. 43. 43.
Similarity - 0.992 0.991 0.991
Ensemble Norm 0.805 - - -
MFE -9.450 -9.601 -8.448 -8.448
Ligands - preQ_1 preQ_1 preQ_1
Gene TTYH2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3. 3.
Length SE - 1. 1. 1.
Lev Distance - 9. 10. 10.
UBS 3. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 1. 0. 0. 0.
BR 1. 0. 0. 0.
UN 0.143 0.116 0.140 0.140

Sequences

Field Description
UTR seq + 25 agaucgcugaguaggagATGAGCGTGGTGGGCCAGGACCGGA
UTR dot + 25 ….((((.(……..).))))((((……..))))..
RS 1 seq GCGGUAGAGGUUCUAGCUACCCUCUUAAAAAAACUAAGGGAAA
RS 1 dot ..(((((………)))))((((((…….))))))…
RS 2 seq GCGGUAGAGGUUCUAGCUACCCUCUUUAAAAAACUAAGGAAAC
RS 2 dot ..(((((………))))).((((((……))))))…
RS 3 seq ACGGUAGAGGUUCUAGCUACCCUCUUUAAAAAACUAAGGAAAA
RS 3 dot ..(((((………))))).((((((……))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table