Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115019 Similarity: 0.974 Similarity: 0.971 Similarity: 0.969
UTR: 5HSAA115019
Gene: TUBA1B
MFE: -32.125
ENS: 0.753
Length: 120.
Predicted Ligands:
SAM - 7/20
glycine - 4/20
cobalamin - 2/20
 RS: URS0000D8EE47_1798705
MFE: -34.640
Ligand: cobalamin
Species: Candidatus Magasanikbacteria bacterium RIFOXYD1_FULL_40_23 AdoCbl riboswitch
 RS: URS0000ABD094_658088
MFE: -18.466
Ligand: glycine
Species: Lachnospiraceae bacterium 9_1_43BFAA Glycine riboswitch
 RS: URS0000D6765D_316067
MFE: -39.984
Ligand: unknown
Species: Geobacter daltonii FRC-32 Candidate Moco riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115019 URS0000D8EE47_1798705 URS0000ABD094_658088 URS0000D6765D_316067
Length 120. 119. 120. 118.
Similarity - 0.974 0.971 0.969
Ensemble Norm 0.753 - - -
MFE -32.125 -34.640 -18.466 -39.984
Ligands - cobalamin glycine unknown
Gene TUBA1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.012 7. 2.003
Length SE - 1. 0. 4.
Lev Distance - 31. 37. 36.
UBS 7. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 3. 1. 4. 2.
ILR 3. 2. 2. 2.
H 3. 3. 3. 3.
BL 1. 2. 1. 1.
BR 1. 2. 3. 1.
UN 0.142 0.252 0.142 0.085

Sequences

Field Description
UTR seq + 25 agugcguuacuuaccucgacucuuagcuugucggggacgguaaccgggacccggugucugcuccugucgccuucgccuccuaaucccuagccacuATGCGTGAGTGCATCTCCATCCACG
UTR dot + 25 …..((((((..(((((((………)))))))..)))))).((((…((((…((…….))…))))……))))………..((((.(((……))).))))
RS 1 seq AUUUAAUUAUAUAUCUGUGGAAGUGAGGUUUGAUUCCUCCACUGUGCCGCAACGGUAAACCCAUGCAAUUGGCUUGGGAAGUCCGAUCUUCAGAUAUAGGCCCUAUAAACAUAGGGUUC
RS 1 dot ……………(((((.(((((((…….)))).)))…))))).(((….((((.((…..)).))))….)))………….((((((((….)))))))).
RS 2 seq AGCUCUCUGGAGAACGCGAGUAUGCGUACCGAAGAAGAAACUUAUGAAAUACGGAAGUUAAGAAUGAUAAUUGAAGUAAAACAUAAGGAAACUUUCAGGUUCGAGGACAGAGAUGAACAA
RS 2 dot …(((.(((…((((……)))).))).)))…..((((((…(((…(((((…….)))))…)))…))))))……((((..(((…….))).))))…
RS 3 seq UUCAUGUAUCAUCUCCGAGCCGUGCAGCCUAACAGGUUCCCUCAUGGUGCCCGGCCUACGGGUUUCGCUGGAAACGGCGGGGCCUCCCUUUCGGAAAGGAGUAAGCAAGCCCUUGCGG
RS 3 dot …..(((((((….(((((((……..)).)))))….)))))))((((…..(((((((((((….)))))))))))…..)))).((((.((……))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table