Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115066 Similarity: 0.974 Similarity: 0.973 Similarity: 0.971
UTR: 5HSAA115066
Gene: TUBB2B
MFE: -38.524
ENS: 0.883
Length: 119.
Predicted Ligands:
cobalamin - 6/20
methionine - 5/20
FMN - 4/20
 RS: URS0000BFDF88_1299333
MFE: -50.530
Ligand: methionine
Species: Mycobacterium xenopi 3993 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000BF54FE_1246476
MFE: -46.158
Ligand: methionine
Species: Arthrobacter crystallopoietes BAB-32 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C7CB5E_293939
MFE: -20.488
Ligand: TPP
Species: Aspergillus lentulus TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115066 URS0000BFDF88_1299333 URS0000BF54FE_1246476 URS0000C7CB5E_293939
Length 119. 118. 119. 118.
Similarity - 0.974 0.973 0.971
Ensemble Norm 0.883 - - -
MFE -38.524 -50.530 -46.158 -20.488
Ligands - methionine methionine TPP
Gene TUBB2B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 1. 15.003
Length SE - 1. 0. 1.
Lev Distance - 33. 36. 31.
UBS 9. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 1.
ILR 3. 3. 3. 5.
H 2. 2. 2. 1.
BL 2. 3. 2. 3.
BR 3. 2. 2. 1.
UN 0.151 0.110 0.151 0.093

Sequences

Field Description
UTR seq + 25 ccgagcgccuucccggugaccccgcagugggugugugaggggaggacggacagacccagacgccgccggaccaggaggacgcugacgaggcaccATGCGTGAGATCGTGCACATCCAGG
UTR dot + 25 …(((((((((((((((…..((..(((((.(((..(…….)..))).)))))…))))))))….))))).))))……((((.((…….)).))))………
RS 1 seq GGUCAUGAGCGCCAGCGCCAAGCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCGGGUGAUGACCAGGUUGAGUAGCCAUCACCGGCUACGCGGCAAGCGCGGGUC
RS 1 dot ((((((…((((.(((((..((((((.(((..((……..))..)))))).)))..)))))…))))))))))..((((.((((((……)))))).))))………..
RS 2 seq AAUCAUGAGCGCCAACACCAAGCCCUGGCUGGUUGGCCGGCAACCCUCUCGCCGUAGCGGGGUGCUCCAGGUGAUGAUUCGGCCCGCUGGCCACCUGGCCUGCGGAGCAAGUACCGCGC
RS 2 dot .((((((((((((….((..((..((((.(((((…..)))))…..))))..)))))))))))…)))))……((((((.((((….)))).)))).))………..
RS 3 seq UUCCUCGCAUACCGAUUGACGGCCCCAGUCAUCAGACAGAAACCUGGUCGUUCUGAGAUUAUACUGUCAUAACUUGAUCUAGAUAAUACUAGCGAAAGGACAUGCGUGGCACUGAUUG
RS 3 dot ..((.(((((.(((((((((((….((((.((((((((….)))…..)))))))))…))))))…….)))………………))..))))).))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table