Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115070 Similarity: 0.976 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA115070
Gene: TUBB2B_0
MFE: -36.574
ENS: 0.775
Length: 115.
Predicted Ligands:
TPP - 5/20
methionine - 5/20
cobalamin - 4/20
 RS: URS0000AB5260_12908
MFE: -22.580
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C5E0E6_1590651
MFE: -26.844
Ligand: TPP
Species: Paenibacillus sp. VKM B-2647 TPP riboswitch (THI element)
 RS: URS0000C1C80B_1548208
MFE: -35.754
Ligand: TPP
Species: Cephaloticoccus capnophilus TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115070 URS0000AB5260_12908 URS0000C5E0E6_1590651 URS0000C1C80B_1548208
Length 115. 116. 115. 115.
Similarity - 0.976 0.974 0.973
Ensemble Norm 0.775 - - -
MFE -36.574 -22.580 -26.844 -35.754
Ligands - cobalamin TPP TPP
Gene TUBB2B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 3. 4.003
Length SE - 1. 0. 0.
Lev Distance - 29. 34. 35.
UBS 9. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 2.
ILR 3. 2. 3. 3.
H 2. 2. 3. 1.
BL 2. 1. 3. 3.
BR 3. 2. 2. 4.
UN 0.139 0.181 0.122 0.087

Sequences

Field Description
UTR seq + 25 gcgccuucccggugaccccgcagugggugugugaggggaggacggacagacccagacgccgccggaccaggaggacgcugacgaggcaccATGCGTGAGATCGTGCACATCCAGG
UTR dot + 25 ((((((((((((((…..((..(((((.(((..(…….)..))).)))))…))))))))….))))).)))…….((((.((…….)).))))………
RS 1 seq GGCCUAAAAGCGUAGUGGGAAAGUGACGUGAAAUUCGUCCAGAUUACUUGAUACGGUUAUACUCCGAAUGCCACCUAGGCCAUACAACGAGCAAGGAGACUCAACAUGAUAAGAUU
RS 1 dot ((((((…((((..(.(((..((((((((….(((………..))))))).))))..))).)))))….))))))…….(((……..)))…………..
RS 2 seq AUAUCAACGCAGGGGUGCUGGAACUAACGGCCGGCUGAGAGUGUAUCCCGUAAGAUACUGACCCUUUAACCUGAUCCGGAUAAUGCCGGCGUAGGGACGCCUACCUUUUCGCUUG
RS 2 dot ..((((….((((((.(.(…((.((((…((…….))…)))).))…).)))))))…..))))((((……)))).(((((….)))))………..
RS 3 seq CCCUGCCUGUAGGGGUGUCCUCCGCGGAGGGCUGAGAUUGCGGCGCGUUACGGCUGCUCGACCCUUCGAACCUGAAACGGAUCAUGCCGACGAAGGAAACAGCAGGCGCACAUCU
RS 3 dot .(((((((((.((.(((…(((((((((((.(((….(((((……..)))))))).)))))))………)))).))).)).))..))……)))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table