Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115135 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA115135
Gene: TUBG1
MFE: -37.062
ENS: 0.905
Length: 87.
Predicted Ligands:
zmp-ztp - 10/20
GMP - 3/20
homocysteine - 2/20
 RS: URS0000DAEBC6_1834512
MFE: -37.016
Ligand: Mg2+
Species: Frankia sp. BMG5.36 ZMP/ZTP riboswitch
 RS: URS0000C7BA35_160660
MFE: -31.990
Ligand: homocysteine
Species: Thiobacillus prosperus S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C0CACC_748449
MFE: -23.774
Ligand: zmp-ztp
Species: Halobacteroides halobius DSM 5150 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115135 URS0000DAEBC6_1834512 URS0000C7BA35_160660 URS0000C0CACC_748449
Length 87. 87. 86. 86.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.905 - - -
MFE -37.062 -37.016 -31.990 -23.774
Ligands - Mg2+ homocysteine zmp-ztp
Gene TUBG1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 4.001 5.003
Length SE - 0. 1. 1.
Lev Distance - 20. 23. 23.
UBS 9. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 2. 3. 1. 1.
H 2. 2. 2. 2.
BL 3. 3. 2. 3.
BR 3. 1. 3. 3.
UN 0.034 0.069 0.058 0.093

Sequences

Field Description
UTR seq + 25 gcgggcuggcgugcggcgccguugcgggcgggagcggcugcaacgccggugccugaggagcgATGCCGAGGGAAATCATCACCCTAC
UTR dot + 25 .((((((((((((((..((((((.(…..).)))))))))).)))))..)))))(((.(.((((((…))….)))).))))..
RS 1 seq GGGCCGAGUCGUGACUGGCGUGCUGGGGUGGAAUCAACCACCGGGGAGCGACCAAUCGGCACGGCACCGUGCGCCUGGGUGCCGCCG
RS 1 dot ..((((((((((..((.(.(((.(((…….)))..)))).))..)))))…))))).(((((((………)))))))…
RS 2 seq GCCGCCGGGGAGCGUUGCAACAGGGCAUAUCCCCUGCCAGGCCUGGCGGCGCGGCCAUUCAUCCAUUGCAACGGCGCUCGCGAACG
RS 2 dot .(((((((…((.(((…(((((……))))).))))))))))))(((((((.((((…..)).)).)))…))))….
RS 3 seq UGCUUAUUAUGUGACUGACGGAUUAGGAUGGGAUUAACCAUCAAGGAGCAUAAUAAGGAGAAUUGCCGACCGUCUGGGCAGAUAGU
RS 3 dot (.((((((((((..((((.((.((((…….)))))).))).)..)))))))))).)…(((((………)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table