Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115282-1 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA115282-1
Gene: TUT1
MFE: -13.538
ENS: 0.932
Length: 63.
Predicted Ligands:
fluoride - 16/20
unknown - 2/20
cobalamin - 1/20
 RS: URS0000E60343_157783
MFE: -19.670
Ligand: unknown
Species: Pseudomonas cremoricolorata nhaA-I RNA
 RS: URS0000C88432_1452487
MFE: -14.596
Ligand: fluoride
Species: Crenobacter luteus Fluoride riboswitch
 RS: URS0000D831B7_3562
MFE: -8.166
Ligand: fluoride
Species: Spinacia oleracea (spinach) Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115282-1 URS0000E60343_157783 URS0000C88432_1452487 URS0000D831B7_3562
Length 63. 63. 62. 63.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.932 - - -
MFE -13.538 -19.670 -14.596 -8.166
Ligands - unknown fluoride fluoride
Gene TUT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.009 17. 5.
Length SE - 0. 1. 0.
Lev Distance - 18. 13. 19.
UBS 7. 5. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 3. 2. 0. 2.
H 1. 1. 1. 1.
BL 2. 1. 4. 3.
BR 2. 2. 4. 1.
UN 0.032 0.127 0.016 0.032

Sequences

Field Description
UTR seq + 25 guuuccggaggaguguguccgcgcaauugaacgacuuuATGTCACTTCCTATCGGATCGGCGG
UTR dot + 25 (((((((((((((.(((.(((..(….)..))…….).)))))))).)))))..)))..
RS 1 seq GGGUGCGUCAGCCAUGUGGCUUGAAUCGCAGGUUAAAAAUCAACGCUGGUCGGGCCGCUAGCG
RS 1 dot .(((.(((((((..(((((((((…..)))))))…..))..))))).)).)))…….
RS 2 seq CGCAGCGUGGGAGAUGGCAUGCCUCCCUAACCGCCUUUACGGCUGAUGAUGCCUACACGCGA
RS 2 dot (((.(.(((((..((.(((.(((……………..))))).).)).))))).)))).
RS 3 seq AUAAAUAGUGGCAAUGAUGUCUGCCUUGAACCGCCUUAAUAAGCUGAUGACGUCUACUUUUAG
RS 3 dot .((((.(((((..(((..(((.((.((((……))))…)).)))..)))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table