Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115301 Similarity: 0.958 Similarity: 0.957 Similarity: 0.957
UTR: 5HSAA115301
Gene: TXK
MFE: -24.126
ENS: 0.893
Length: 149.
Predicted Ligands:
glucosamine - 8/20
cobalamin - 5/20
TPP - 3/20
 RS: URS000233174F_1129794
MFE: -23.614
Ligand: cobalamin
Species: Paraglaciecola psychrophila 170 Cobalamin riboswitch
 RS: URS000231F1B4_1714016
MFE: -25.743
Ligand: cobalamin
Species: Domibacillus iocasae Cobalamin riboswitch
 RS: URS0000C24689_763407
MFE: -25.197
Ligand: TPP
Species: Phycomyces blakesleeanus NRRL 1555(-) TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115301 URS000233174F_1129794 URS000231F1B4_1714016 URS0000C24689_763407
Length 149. 148. 148. 149.
Similarity - 0.958 0.957 0.957
Ensemble Norm 0.893 - - -
MFE -24.126 -23.614 -25.743 -25.197
Ligands - cobalamin cobalamin TPP
Gene TXK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 8. 14.004
Length SE - 1. 1. 0.
Lev Distance - 53. 54. 54.
UBS 6. 8. 8. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 3.
ILR 1. 2. 2. 4.
H 4. 4. 4. 2.
BL 0. 1. 1. 0.
BR 0. 1. 1. 0.
UN 0.282 0.270 0.291 0.221

Sequences

Field Description
UTR seq + 25 uuugucuuccacuagugaaggaaggcacgaucgagacuuucauacgcuuuauaauaauucgucucacccuucccuuagagacucccucaauaucacguacucauggcuuucuaacagcugagaaATGATCCTTTCCTCCTATAACACCA
UTR dot + 25 ..((((((((………))))))))…..(((((…………………..)))))…………(((…..)))…((((….(((..((((…….)))))))…))))………………..
RS 1 seq GUCGCCUAUAAAUAAGGUUUUGGGUUGAUAUUGCUCGCAAUAAACACCCAAAUAAUUGGGAAUUUGGUGAAAAUCCAAAACUGUACCCGCAACUGUAAACGUUUAUAUAACACGUCAGUCAGAUACCAGCCUUAUACAAUCUUGAAGU
RS 1 dot …((((…….))))(((((((…(((((….)))))…)))))))…..(((.((((((…….))))….)).)))…((((…((((………))))))))………………………..
RS 2 seq AAUGAAUAAUUAUUUAUAAGUGCUCGAAACGAAAUUGUGGAGAGAUAAUAGGGAAUCCGGUGUAAAUCCGGAGCAGCCCCCGCUACUGUAAAAGCAUGUUCUUUAAACUUGCUUAAGCCAGGAAACCUGCUUAUAAAUAGAUACGUCU
RS 2 dot .((((((….))))))……………….((((……….(((..(((((…….)))))….)))))))….((..(((((.(((…..))).)))))..))((((…))))……………….
RS 3 seq AUUUGACUCGAGGGGUGCUGCAAAAAAAAAAGAUUUUGAUUUGGGAAUAACAAAAAAAAAAAGUAAAAGAAGAUCUUUAAGCGGCUGAGAUUAUACCCUUAAAAACGGAUCAGGGUAAUUCCUGCGACGUGAUGAUGACCUUUGUACCU
RS 3 dot ……….(((((((((((…….(((((((((..((((………………..))))..)))))))))..)))))………))))))….(((…(((((….)))))…)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table