Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115354 Similarity: 0.991 Similarity: 0.986 Similarity: 0.984
UTR: 5HSAA115354
Gene: TXNDC8
MFE: -12.866
ENS: 0.968
Length: 74.
Predicted Ligands:
fluoride - 5/20
Ni/Co - 3/20
purine - 3/20
 RS: URS0000D9F08B_1419482
MFE: -16.208
Ligand: fluoride
Species: Chitinophaga jiangningensis Fluoride riboswitch
 RS: URS0000D65DDB_1121930
MFE: -16.375
Ligand: 2'-dG-II
Species: Gracilimonas tropica DSM 19535 2'dG-II riboswitch
 RS: URS0000D6C285_12908
MFE: -22.109
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115354 URS0000D9F08B_1419482 URS0000D65DDB_1121930 URS0000D6C285_12908
Length 74. 74. 75. 75.
Similarity - 0.991 0.986 0.984
Ensemble Norm 0.968 - - -
MFE -12.866 -16.208 -16.375 -22.109
Ligands - fluoride 2’-dG-II Ni/Co
Gene TXNDC8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.019 2.
Length SE - 0. 1. 1.
Lev Distance - 12. 16. 20.
UBS 2. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 0.
H 2. 2. 2. 3.
BL 0. 1. 1. 0.
BR 0. 1. 1. 0.
UN 0.365 0.338 0.227 0.387

Sequences

Field Description
UTR seq + 25 uccaacuaaaccaacaggggauuuucaucagcacuucccugguguaaucATGGTACAGATTATTAAAGACACGA
UTR dot + 25 …………..(((((((………….)))))))..((((((……..))))))………..
RS 1 seq AGUCUACCAGGAAAUGGUGUCUUCCUGCUUUGAAACCGUUUCGCAUCGCCGAAACUGAUGGCGCCUACAAAUAU
RS 1 dot ……….((((((((.((……….)).))))))))….(((((…….)))))………..
RS 2 seq GAUUAGUGUAAUUCCCGGCAAUAAGGACAGGGAAGCUUCCACCGGCCAACCGUAAAUUGGCUGUCACCACUUCUC
RS 2 dot …..(((.(((((((………….)))))..)).)))(((((((…….)))))))…………
RS 3 seq AUAAUGCAAACUCAUCAGGCUGCAAAGCAGCCGGGCCUUACGGCAGCAGAUUAUACCUACAUCUGCGGGACAAAA
RS 3 dot ……………..((((((…))))))..(((….))).((((((………))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table