Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115355 Similarity: 0.988 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA115355
Gene: TXNDC8_0
MFE: -12.866
ENS: 0.963
Length: 70.
Predicted Ligands:
2'-dG-II - 9/20
purine - 4/20
fluoride - 3/20
 RS: URS0000DDBA0A_2182327
MFE: -12.737
Ligand: fluoride
Species: Candidatus Nitrotoga fabula crcB
 RS: URS0000D6A616_12908
MFE: -26.194
Ligand: 2'-dG-II
Species: unclassified sequences 2'dG-II riboswitch
 RS: URS0000D6C6C7_12908
MFE: -22.371
Ligand: 2'-dG-II
Species: unclassified sequences 2'dG-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115355 URS0000DDBA0A_2182327 URS0000D6A616_12908 URS0000D6C6C7_12908
Length 70. 69. 71. 70.
Similarity - 0.988 0.987 0.986
Ensemble Norm 0.963 - - -
MFE -12.866 -12.737 -26.194 -22.371
Ligands - fluoride 2’-dG-II 2’-dG-II
Gene TXNDC8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 0. 9.025
Length SE - 1. 1. 0.
Lev Distance - 14. 17. 16.
UBS 2. 3. 2. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 2.
ILR 0. 1. 0. 1.
H 2. 2. 2. 2.
BL 0. 1. 0. 0.
BR 0. 0. 0. 0.
UN 0.329 0.275 0.324 0.171

Sequences

Field Description
UTR seq + 25 acuaaaccaacaggggauuuucaucagcacuucccugguguaaucATGGTACAGATTATTAAAGACACGA
UTR dot + 25 ……….(((((((………….)))))))..((((((……..))))))………..
RS 1 seq UAUGUAAUUGGAGAUGGUAUUCCUCCAUUAACCGCUGCUCCACCGACAGCUAAUGAUGUCUACGUACAA
RS 1 dot ……..(((((.((((…………))))…)))))..((((……..))))………
RS 2 seq UAUCCUUAUAAUCUGGCGGAUUGGCGCUAGAUUAUACACGACCGGACCUUAAUCCGGUGUAUCCAGGGAAA
RS 2 dot ……((((((((((((……))))))))))))….((((((……))))))………….
RS 3 seq UGUGCCUGUAAUCCUUGAGAUCCGGUCAAGGAGCAUCCACCCCCGAACCUAAUCCGGGGUACCAGGAGAA
RS 3 dot .(((..(((..(((((((…….))))))))))..)))(((((………)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table