Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115466 Similarity: 0.947 Similarity: 0.946 Similarity: 0.945
UTR: 5HSAA115466
Gene: TYW1
MFE: -79.742
ENS: 0.923
Length: 189.
Predicted Ligands:
TPP - 9/20
cobalamin - 4/20
Mn2+ - 3/20
 RS: URS0000D90B32_1882757
MFE: -83.874
Ligand: TPP
Species: Streptomyces sp. 3214.6 TPP riboswitch (THI element)
 RS: URS0000D9E449_1305826
MFE: -84.524
Ligand: TPP
Species: Streptomyces sp. Amel2xC10 TPP riboswitch (THI element)
 RS: URS0000C3524B_1725411
MFE: -79.117
Ligand: TPP
Species: Streptomyces sp. CdTB01 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115466 URS0000D90B32_1882757 URS0000D9E449_1305826 URS0000C3524B_1725411
Length 189. 190. 189. 190.
Similarity - 0.947 0.946 0.945
Ensemble Norm 0.923 - - -
MFE -79.742 -83.874 -84.524 -79.117
Ligands - TPP TPP TPP
Gene TYW1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.003 14.003 12.002
Length SE - 1. 0. 1.
Lev Distance - 65. 67. 67.
UBS 11. 13. 13. 13.
BS 2. 0. 0. 0.
ILL 3. 4. 3. 4.
ILR 2. 3. 1. 3.
H 5. 6. 6. 6.
BL 2. 2. 2. 1.
BR 2. 3. 4. 2.
UN 0.106 0.047 0.048 0.063

Sequences

Field Description
UTR seq + 25 gaaccaaucaggaccggccuggcagugucauggcugcccacaggucugcaggcacucgguacgccgcuaacgcggcgagguagcucggugcgucucgcgguaccagugcgaaucaucgggcuauccagguccgagauccuagucuccugucggcucugaggaggATGGATCCTTCTGCGGATACATGGG
UTR dot + 25 …((…..))..(((((((((…)))).)))))((((…(((((((((((((.(((..(((((..(((((.((((….)))).)))))…)))))))))))))……(((((((…..)))))))(((((…((((((……….))))))..)))))…))))))))…))))
RS 1 seq CUUUGCACACGCGGGAGCUCGGAGCACCGGGCUGAGAGGGCGCUGACCUCCGUCUUAGCGAUGUUUCACGUGGAACGUCUCUCGAUUCGAGUGAUGUUUCACAGGAAACGUCGGCAGGCGGUAGCCGCUGCGUCGACCGCCGAACCUGUUACCGGGUAAUGCCGGCGUAGGGAGUAGGUCUCAUGACCAA
RS 1 dot .(((((….)))))(((((((….)))))))..((((…….))))(((((…(((((((((..((((((((((.((((…)))).))))))))))..)))))))))..)))))…(((.((((((((…((…(((((….)))))…)))))))))).).)).((((….))))..
RS 2 seq CUUUGCACACGCGGGAGCUCGGAGCACCGGGCUGAGAGGGCGCUGACCUCCGUCUUCGCGAUGUUUCACGUGGAACGUCACUUCGCUGAGUGAUGUUUCACAUGAAACAUCGGUGAACGGUAGCCGCUGCGUCGACCGCCGAACCUGUUACCGGGUAAUGCCGGCGUAGGGAGUAGGUCUCAUGACCAA
RS 2 dot .(((((….)))))(((((((….)))))))..((((…….))))(((..(((((((((((((.((((((((((((((….)))))))))))))).)))))))))).))))))…(((.((((((((…((…(((((….)))))…)))))))))).).)).((((….))))..
RS 3 seq CUUUGCACACGCGGGAGCUCGGAGCACCGGGCUGAGAGGGCGCUGACCUCCGUCCCCACGAUGUUUCACGUGGAACAUCACCGAACACGAGUGAUGUUCGCCACGAAACGUCGCCAGACGGAAAUCGCUGCGUCGACCGCCGAACCUGUUACCGGGUAAUGCCGGCGUAGGGAGUAGGUCUCAUGACCAA
RS 3 dot .(((((….)))))(((((((….)))))))..((((…….))))((((….(((((((((..((((((((((((((….)).))))))))..)))))))))))))…))))….((.((((((((…((…(((((….)))))…)))))))))).))…((((….))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table