Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115510 Similarity: 0.989 Similarity: 0.986 Similarity: 0.983
UTR: 5HSAA115510
Gene: U2AF1L4
MFE: -15.270
ENS: 0.965
Length: 69.
Predicted Ligands:
fluoride - 9/20
cobalamin - 5/20
glycine - 2/20
 RS: URS0000DA2329_1564159
MFE: -26.987
Ligand: cobalamin
Species: Geodermatophilus pulveris Cobalamin riboswitch
 RS: URS0000D876D8_1703929
MFE: -26.037
Ligand: cobalamin
Species: Streptomyces sp. CB01249 Cobalamin riboswitch
 RS: URS000233041F_1817817
MFE: -12.551
Ligand: cobalamin
Species: Candidatus Delongbacteria bacterium GWF2_40_14 AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115510 URS0000DA2329_1564159 URS0000D876D8_1703929 URS000233041F_1817817
Length 69. 69. 69. 69.
Similarity - 0.989 0.986 0.983
Ensemble Norm 0.965 - - -
MFE -15.270 -26.987 -26.037 -12.551
Ligands - cobalamin cobalamin cobalamin
Gene U2AF1L4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 4.003 6.003
Length SE - 0. 0. 0.
Lev Distance - 14. 18. 21.
UBS 4. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 4.
ILR 3. 2. 2. 3.
H 1. 1. 1. 1.
BL 1. 1. 0. 0.
BR 0. 1. 1. 0.
UN 0.087 0.145 0.145 0.029

Sequences

Field Description
UTR seq + 25 ggaagugacguaagagcagccagaccuggagggcuuggguaaaaATGGCTGAATATTTAGCTTCGATAT
UTR dot + 25 .(((((…(((….((((((.((((((…..))))))…..))))))..)))…)))))…..
RS 1 seq GAGGAAGCCGGUGUGAUCCCGGCGCGGUCCCGCCACUGUGAGCCCGGGACGCGGGCGAGCCAGACACUC
RS 1 dot ..((..(((.(((…((((((((((((……))))))…))))))))).)))…))……..
RS 2 seq GAGGAAGCCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUGACCGGGCACGACCCGGGAGCCAGACACUC
RS 2 dot ..((…((((((((..(((((((((((……)))))).)))))))))..))))…))……..
RS 3 seq GUCCGGCCAUGGAAUUCUGUGAAAGUCAGAAACUGCCCCGCAACCGUUACAGUCGGAUCUUUACCGGAA
RS 3 dot .(((((….(((…((((((..((…….(((…)))))..))))))…..)))…))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table