Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115729 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA115729
Gene: UBA52
MFE: -29.493
ENS: 0.758
Length: 117.
Predicted Ligands:
molybdenum - 10/20
FMN - 5/20
glycine - 2/20
 RS: URS0000C55168_1617411
MFE: -26.976
Ligand: SAM
Species: Chlorobi bacterium OLB4 SAM riboswitch (S box leader)
 RS: URS00020F9A3B_1898204
MFE: -33.893
Ligand: FMN
Species: Clostridiaceae bacterium FMN
 RS: URS0000043C71_479831
MFE: -23.274
Ligand: FMN
Species: Clostridium difficile QCD-63q42 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115729 URS0000C55168_1617411 URS00020F9A3B_1898204 URS0000043C71_479831
Length 117. 117. 117. 116.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.758 - - -
MFE -29.493 -26.976 -33.893 -23.274
Ligands - SAM FMN FMN
Gene UBA52 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 1. 4.
Length SE - 0. 0. 1.
Lev Distance - 34. 36. 34.
UBS 8. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 1.
ILR 1. 0. 1. 2.
H 4. 3. 4. 4.
BL 2. 3. 2. 2.
BR 2. 3. 2. 1.
UN 0.274 0.299 0.274 0.284

Sequences

Field Description
UTR seq + 25 gcuccgugcgcaagcgcuuucggcggcgauuaggugguuuccgguuccgcuaucuucuuuuucuucagcgaggcggccgagcugacgcaaacATGCAGATCTTTGTGAAGACCCTCA
UTR dot + 25 …..((((….))))….(((((.(((..((……)).))))))))………….(((((..((…))..)))))((((((.((….)).))))))……….
RS 1 seq GACUUAUUACGAAAGGUGGAGGGAGUAGGCCCGAAGAAACCUUGGCAACCGUUCCGUUACAGUACCGGAAAAAUGGUGCUAAUUCCUAUCCCGCUAAGUAUAGGGAAAAGAUAAGUU
RS 1 dot ……………..((((.(.((..(((..(((….)))))).))).))))…..(((((((……)))))))..(((((((.(……).)))))))………..
RS 2 seq AGUAAUCUUCAGGGCGGGGUGUAAUUCCCCACCGGCGGUACAGCCCGCGAGCCCCAAAGGGUAUGAUUCGGUGAAAUUCCGAGGCCGACAGUAAAGUCUGGAUGGAAGAAGUGAGAA
RS 2 dot ………….(((((.((((…((((…)).)))))).)))))..((((….))))….(((((…….))))).(((.(((……)))..)))…………
RS 3 seq GUUUUUCUUCAUAAACGGGUGAAAUUCCCUAUCGGCAGUAAAAGCCCGCGAGCCUUAUGGCAUAAUUUGGUCAUAUUCCAAAGCCGACAGUAAAAUCUGGAUGGUAGAAGAAAAUA
RS 3 dot ……………(((((…(((.((….)).)))….)))))…(((….)))….(((((…….)))))((((.(((……)))..))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table