Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115795 Similarity: 0.966 Similarity: 0.966 Similarity: 0.965
UTR: 5HSAA115795
Gene: UBAP2
MFE: -37.659
ENS: 0.932
Length: 138.
Predicted Ligands:
molybdenum - 5/20
cobalamin - 4/20
FMN - 4/20
 RS: URS0002329FE0_385025
MFE: -23.436
Ligand: cobalamin
Species: Cycloclasticus sp. P1 Cobalamin riboswitch
 RS: URS0000AB7C03_471855
MFE: -45.550
Ligand: FMN
Species: Slackia heliotrinireducens DSM 20476 FMN riboswitch (RFN element)
 RS: URS0000AB9380_161544
MFE: -39.256
Ligand: FMN
Species: Bacillus sp. SG-1 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115795 URS0002329FE0_385025 URS0000AB7C03_471855 URS0000AB9380_161544
Length 138. 139. 139. 137.
Similarity - 0.966 0.966 0.965
Ensemble Norm 0.932 - - -
MFE -37.659 -23.436 -45.550 -39.256
Ligands - cobalamin FMN FMN
Gene UBAP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 3. 7.001
Length SE - 1. 1. 1.
Lev Distance - 41. 43. 43.
UBS 11. 11. 12. 13.
BS 0. 0. 0. 0.
ILL 4. 4. 3. 5.
ILR 4. 5. 5. 4.
H 3. 3. 3. 2.
BL 3. 4. 3. 3.
BR 4. 2. 4. 5.
UN 0.065 0.050 0.050 0.029

Sequences

Field Description
UTR seq + 25 gugacgcgaggucacgugacggguugggcagccugugccgccgccgccgcuuuguaagaggcacauuggcagauuuucuauuuuguacauacauuauuuuguauauacuguauATGAACACCGCGAACAGCCTCTGTC
UTR dot + 25 (((((…..)))))(((.(((….((((…..))))….))).)))……((((((…((.((…..((((((…(((.(((((……))))).)))…))).)))….)).))..))))))…
RS 1 seq AUCUUGCUAGCCAAGAAACAUUUAAGCACUAUAUAUAGUAUUUGAGGGGAAUCUGGUUAGAAUCCAGAACUGUCGCGCAACGGUGUUGUGAAUCUUAUAUUCACUCAGUCCGAUUACCUCUAUUUUUUGCCAAGCCUCG
RS 1 dot .(((((…..)))))…..(((((.((((….)))).)))))((((….((((.(((((..(((…((((.((…((((.(((((…)))))..))))..)).))))….))))))))..))))..)))).
RS 2 seq AUUCUGUUUCAGGGCGGGGUGGAAGUCCCCACUGGCGGUAAACCUGCAUGGCAAGUCCGCGACCCCGAGGCUGCGGCUUCGGGCUGACUUGGGUUAGAUUCCCAGACCAACGGUACAGUCCGGAUGGAAGAAGCAGAAG
RS 2 dot .(((((…)))))((((((.(..(.(.(((…((((…..)))).)))…).)..).))))))…((((..(((((((((((((((((…….))))…….))).))))))…..))))..))))…
RS 3 seq AUUCGUCUUCGGGGCAGGGUGUAAUUCCCGACCGGCGGUAAUGAAUGAUUUCAUUCUAAGCCCGCGAGCCUGUUGUUUGGGCAGGAUUUGGUGAGAUUCCAAAGCCGACAGUAUAGUCUGGAUGGGAGGAGAUGAAG
RS 3 dot ((((((..(((.((..(((…….)))..))..)))..))))))…((((((((…(((((.((.((((((((..(((….(((((…….))))))))))))..)))).)).).)))).)))).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table