Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115803 Similarity: 0.941 Similarity: 0.941 Similarity: 0.941
UTR: 5HSAA115803
Gene: UBAP2L
MFE: -43.564
ENS: 0.941
Length: 192.
Predicted Ligands:
cobalamin - 12/20
lysine - 6/20
TPP - 1/20
 RS: URS0002332789_350688
MFE: -37.705
Ligand: cobalamin
Species: Alkaliphilus oremlandii OhILAs Cobalamin riboswitch
 RS: URS0000DA8141_1780378
MFE: -44.375
Ligand: lysine
Species: Clostridiales bacterium CHKCI001 Lysine riboswitch
 RS: URS000232CCF7_1262783
MFE: -42.508
Ligand: cobalamin
Species: Clostridium sp. CAG:242 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115803 URS0002332789_350688 URS0000DA8141_1780378 URS000232CCF7_1262783
Length 192. 192. 193. 193.
Similarity - 0.941 0.941 0.941
Ensemble Norm 0.941 - - -
MFE -43.564 -37.705 -44.375 -42.508
Ligands - cobalamin lysine cobalamin
Gene UBAP2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.004 9.011 14.
Length SE - 0. 1. 1.
Lev Distance - 77. 74. 72.
UBS 10. 10. 11. 11.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 1.
ILR 3. 3. 1. 2.
H 4. 5. 5. 6.
BL 2. 2. 3. 4.
BR 2. 0. 3. 2.
UN 0.214 0.276 0.109 0.233

Sequences

Field Description
UTR seq + 25 aagugggcgggggaaggcgcgagagcgagcgcgagagggaaaaggagggaggggguggggaagagggaaucuuauaucacgugacaggggcggcgcggcccggggugucaguguggaggagacugaguauucuaccuuguaaauacuguuauuuguauauacuguaaATGATGACATCGGTGGGCACTAACC
UTR dot + 25 …………….((((……..))))……………..(.(((((((((…..((..((((…((((((((((.((((……))))….))))).)))))))))..))…..))))))))).)……(((((((…………….)))))))..(((……..)))
RS 1 seq GACGAAUUCAAUAUAGAAGGUGCUCAAUUGAGCUUAAAAGGGAAAAUGGUUAAAAUCCAUUACAGCCCCCGCUACUGUAGGUGAUGAUGAAUCGGCAAUGAACCACUGAUCUAGGAAUUUAAAGCUAGGUUGGGAAGGUGCUGAGGAAAAUGAUUCACGAGUCAGGAGACCUGCCGACUUUAGAUAAAUGAU
RS 1 dot …………………((((….))))……(((..(((((…….)))))…..)))((((……))))……..(((((…..(((.(((((((((……….)))))))))…))))))))……….((..(((((.((…….)))))))..))……..
RS 2 seq UAGAAAAGUAGAGGUUGCGUGAUUGAUGAGUAAGCUGUUGGAUAUGUUCUGGCAUAGAAGAAGGCAGUGGAAAGGUGAGAACGCCGAAGGAAUGGAUGCCAGAAUAUCAGUUCCUGGGAAUAUGGUGAAUAACCAUAUAACUGUCAUCUGAUCAAGUUUCUAUCCUAGUGUCAGAUGGGGAGCUACUUAGAGC
RS 2 dot ………..((.((((………..)))).))…….((((((((((((…….(((.((…………)))))……….))))))))))))(((((…….(((((((…..))))))))))))((((((((((.((……..)).).)))))))))…(((……)))
RS 3 seq AUCGUAAACAGGACUAUAGGUGUGCAUAGCACAUAAAAGGAAUCAGGUGUAAAUCCUGAACAAGGCCGUUGCCGUGUUUAGCUAAACUAUACGCAAGAUAGAAAUAUCAGCCACUGGAUUAUCUGGGAAGGCGCGUAUAUGCUGGUAUUCAGCAGCUAUCAGUCGGAAUACUUGCCUAGGGUUCACUCGUUAC
RS 3 dot ……………….((((((…))))))………..(((….)))(((((((.(((….))).)))))))……(((((((……………(((.(((((…)))))…)))))))))).((.(((((((.((……..))..))))))).))…(((….)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table