Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115804 Similarity: 0.975 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA115804
Gene: UBAP2L_0
MFE: -29.104
ENS: 0.988
Length: 138.
Predicted Ligands:
TPP - 12/20
molybdenum - 3/20
Ni/Co - 2/20
 RS: URS0000AB60AB_3641
MFE: -45.006
Ligand: TPP
Species: Theobroma cacao (cacao) TPP riboswitch (THI element)
 RS: URS0000D8F7DB_210143
MFE: -51.006
Ligand: TPP
Species: Corchorus capsularis TPP riboswitch (THI element)
 RS: URS0000D8ADFB_49451
MFE: -39.421
Ligand: Ni/Co
Species: Nicotiana attenuata TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115804 URS0000AB60AB_3641 URS0000D8F7DB_210143 URS0000D8ADFB_49451
Length 138. 138. 139. 136.
Similarity - 0.975 0.969 0.968
Ensemble Norm 0.988 - - -
MFE -29.104 -45.006 -51.006 -39.421
Ligands - TPP TPP Ni/Co
Gene UBAP2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 20.001 14.
Length SE - 0. 1. 4.
Lev Distance - 29. 32. 31.
UBS 10. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 4. 4. 3. 4.
ILR 3. 3. 2. 2.
H 3. 3. 3. 3.
BL 2. 1. 1. 2.
BR 1. 4. 5. 4.
UN 0.051 0.080 0.079 0.044

Sequences

Field Description
UTR seq + 25 gggucggcccgacuaagugacuuaaacucccaccuacuccuggaauaaggagucaaagcccggauaggcgcaguauucuaccuuguaaauacuguuauuuguauauacuguaaATGATGACATCGGTGGGCACTAACC
UTR dot + 25 .(((((…)))))..(((.((((…(((…((((((((……))))))…))…))))))))))(((..((((((.(((……(((((((((((…..))))))))))))))..)))))).)))….
RS 1 seq AAAACGCACCAGGGGUGCCUGUAUCUGCUUUUAGCUCUUUGGCAUUUUGGCCAGGAUGCCGUGGCAGAUGAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGUAGGGAGUGUGCAUUUUCUUUUUC
RS 1 dot …..(((((…)))))((.((((((((….((..((((((……))))))..))…)))))))).))..(((((((((((((….((((..((((……))))..))))))).).).))))))))….
RS 2 seq AAAACGCACCAGGGGUGCCUGUAUCUGCUAUUAGCUCUUGGCAUUUUUGGCCAGGAUGCUACCGGCAGAUGAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGAUAAUGCCUGCGUAGGGAGUGUGCAUUUUCUUUUCC
RS 2 dot …..(((((…)))))((.((((((((..(((((((((((…….))))))).))))..)))))))).))..(((((((((((((….((((..((((……))))..))))))).).).))))))))….
RS 3 seq AGAAAGCACCAGGGGUGCCUGUGUCAGCUUCAGAAACCUGGCCUUAUUAGCCAUAAUGCUGACUGAACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGAUAAUUCCUGCGUAGGGAGUGUGCAUUUUUUUUGUU
RS 3 dot …..(((((…)))))((((.((((..((((…..((((…….))))…..))))))))))))((.(((((((((((((….((((..(((((….)))))..))))))).).).)))))))).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table