Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115834 Similarity: 0.957 Similarity: 0.955 Similarity: 0.955
UTR: 5HSAA115834
Gene: UBAP2L_1
MFE: -40.
ENS: 0.909
Length: 158.
Predicted Ligands:
FMN - 6/20
glucosamine - 5/20
Mg2+ - 2/20
 RS: URS0000D9BFF0_1797535
MFE: -49.355
Ligand: FMN
Species: Candidatus Buchananbacteria bacterium RIFCSPHIGHO2_01_FULL_44_11 FMN riboswitch (RFN element)
 RS: URS0000D80684_1775671
MFE: -44.964
Ligand: lysine
Species: delta proteobacterium ML8_F1 Lysine riboswitch
 RS: URS0000BEB522_82374
MFE: -53.499
Ligand: glucosamine
Species: Anaerovibrio lipolyticus glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115834 URS0000D9BFF0_1797535 URS0000D80684_1775671 URS0000BEB522_82374
Length 158. 157. 155. 157.
Similarity - 0.957 0.955 0.955
Ensemble Norm 0.909 - - -
MFE -40. -49.355 -44.964 -53.499
Ligands - FMN lysine glucosamine
Gene UBAP2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.018 4.004 12.005
Length SE - 1. 9. 1.
Lev Distance - 55. 46. 54.
UBS 10. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 2.
ILR 1. 1. 0. 3.
H 5. 5. 4. 3.
BL 2. 3. 2. 4.
BR 3. 3. 3. 3.
UN 0.120 0.255 0.187 0.051

Sequences

Field Description
UTR seq + 25 gagcagccguaggaagggggggccaugcggcuagagccugagaggggagagcgagaaagagcgcgagcgagcgaggccugggccuugccugaguauucuaccuuguaaauacuguuauuuguauauacuguaaATGATGACATCGGTGGGCACTAACC
UTR dot + 25 ….(((((((((………)).)))))))….(((….)))….(((……..)))…((.(((((((….))))))).))(((..((((((.(((……(((((((((((…..))))))))))))))..)))))).)))….
RS 1 seq AAUAUCCUUCGGGGUCGGGUGAAAGUCCCAAUCGGUGGUAAAGCCCACGAGCCCAUAGCCGGGCAUGAUCUGGUGUAAUUCCAGAGCCGACCGUAUGCCGAUGUAAAAUCGGCAUCCUGAUUCUAUAUCGGGAAAGUCGGGAUGAAAGAAGGUAAUU
RS 1 dot ………..(((.(……..).)))…..((((……))))..((((……))))….(((((…….))))).(((((….(.((((((((.((((((….)))))).)))))))).)..)))))……………..
RS 2 seq UGCAUUUAAAGAGGUUGCAUCCGACAAGAGUACCUGGACGACAGGGAAAGGGGAAGAUGCCGAAACAGCCGGAUUCCGGCCGUUGGGCUUGCAUUUAAGAGAUGCAGGACUUUGGAGUUUCUAUCCCAAAAGAAGCUUCAAGCGCUUUUUAUGCC
RS 2 dot ((((………..))))………….((((…..))))………….(((..(((.(((((…))))).))).)))..((((..(((((.(((……(((((((((((……..))))))))))))))))))).)))).
RS 3 seq CUGAUUGUUCUAGCGCAUGGCCUUGCUUUGGAAUAAAGCAAGGUGACGAGGAAGAGGUUGUCGAUUUAUCAGCGGAUGCCUCUCGGCUUGCCGGUCGUUAGAAUGCUGUUAAAACUGUUGGGUGACUGACAGGACAGAGCGGCAUUUGGGCAGGACA
RS 3 dot ….(((((((((.(((……))).))))))))).(((((.(((.((((…..((((………))))…..))))))).)))))..((((((.((((((((((….(((((((….)))))))…..)))))))))).)))..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table