Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115859 Similarity: 0.926 Similarity: 0.920 Similarity: 0.916
UTR: 5HSAA115859
Gene: UBAP2L_2
MFE: -62.
ENS: 0.876
Length: 257.
Predicted Ligands:
cobalamin - 18/20
glucosamine - 1/20
lysine - 1/20
 RS: URS000231799D_1423323
MFE: -54.306
Ligand: cobalamin
Species: Flavobacterium sp. AED Cobalamin riboswitch
 RS: URS000231389D_655815
MFE: -50.489
Ligand: cobalamin
Species: Zunongwangia profunda SM-A87 Cobalamin riboswitch
 RS: URS000231E4B0_582744
MFE: -93.245
Ligand: cobalamin
Species: Methylovorus glucosetrophus SIP3-4 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115859 URS000231799D_1423323 URS000231389D_655815 URS000231E4B0_582744
Length 257. 259. 258. 257.
Similarity - 0.926 0.920 0.916
Ensemble Norm 0.876 - - -
MFE -62. -54.306 -50.489 -93.245
Ligands - cobalamin cobalamin cobalamin
Gene UBAP2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 5.001 13.
Length SE - 4. 1. 0.
Lev Distance - 88. 103. 105.
UBS 15. 16. 14. 17.
BS 0. 0. 0. 0.
ILL 4. 6. 4. 4.
ILR 5. 4. 4. 5.
H 5. 5. 6. 7.
BL 4. 3. 3. 5.
BR 4. 3. 3. 2.
UN 0.163 0.166 0.194 0.148

Sequences

Field Description
UTR seq + 25 aagugggcgggggaaggcgcgagagcgagcgcgagagggaaaaggagggaggggguggggaagagggaaucuuauaucacgugacaggggcggcgcggcccggggugucaguguggaggagacugaguauucuaccuuguaaauacuguuauuuguauauacuguaaaugaugacaucggugggcacuaaccgagcccggggaaacugggaacaaccucaaaaccaaaaccaATGATGACATCGGTGGGCACTAACC
UTR dot + 25 …………….((((……..))))……………….(((((((((…..((..((((…((((((((((.((((……))))….))))).)))))))))..))…..)))))))))(((.((((……..)))).)))…….((((.(((((.(((………((((((((…..)))))……)))……….))).))))).))))(((……..)))
RS 1 seq CCGCCGUAUUGAGGUUGAGGUUUGUUUUUUCAAACCACAUUAAAAGGGAAUCAGGUGAAAGAUUUCAAGUUUUAGAUUUCAGAUUUUAGGUUUAAAUCCUAAAUCAUGAAUCCUAACUUAAAUCAAGAAUCCUGAGCUGUACCCGCAACUGUAAGCUAUCAAGCUUGUUGUUAUCUACAAAACCAUUGUUCGCCGCGGCGAAUGAGAAGGUAAACAACAAGACGCAAGCCAGGAGACCUGCCUAUUACAUCGAGUAUCA
RS 1 dot ..(((…….)))…((((((……))))))………(((..(((((…..(((((.((((..(((..((((((.((((((…….)))))))).))))..))))))))))))……)))))……)))……….(((……(((((((((((((.(…….(((((((……)))))))).)))))).)))))))…..)))((((…))))……………….
RS 2 seq UUUUCGCAUCGAAAUUUUGGUUCGCUAAUACCGAUUAAAAGGGAAUCAGGAAAAGUUAGAAGCGCUAAAUUAGAACUACGAAGUAUAAGUAGGUAAUUGAAAUCUUUUAAUUAAUAAAACCUGAGCUGUUCCCGCAACUGUAAGCUUUGUUCCUAUUGGAAUGCUUGUAAAAAACUUCAAAUACCACUGUCUGCAAUAAGAUGGGAAGGUAAUUUACAGGACGCUAGCCAGGAGACCUGCCAGAAAUAAUAAAAACAC
RS 2 dot .(((((…)))))..(((((……..)))))……((((((((((…(((((((((…..(((((…((((………)))).)))))…..)))))))))…….)))))….)))))…..(((((((…(((((….))))))))))))…………((((.((((((……))))))…))))…..((((.(.((…..)).).))))……………….
RS 3 seq UUACAUUGCCAGCACUACGGUCCUCAAGGUUUGAUUCAAACCGCGAGUUAAAAGGGAAUCCGGUGCGUGUGUUUGCAGAAUAUUUCUCGCAGGCAUGCAACGCCGGGGCUGCCCCCGCAACUGUAACCAGCCAUCGGGCUGACGCUUAGUCAGUCUGAUAGCGCAAGGCAUCUUAAGCCACUGAACCUGCCGGGGUUCGGGAAGGCGCCAAGCGUAAGGCCGGGAGCCAGGAGACCUGCCGUGGAUUUUUUCAACGC
RS 3 dot …….(((……..))).(((..((((((…))))))..)))…………((((((.((((((((((((((…)))).))))))))))..))))))(((((…..((….))…)))))(((((((((((…..))))))))))).((((..(((…….(((.((((((((….))))))))…))))))..))))….(((.(.(.((((…)))))).)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table