Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115905 Similarity: 0.950 Similarity: 0.949 Similarity: 0.949
UTR: 5HSAA115905
Gene: UBAP2L_3
MFE: -45.315
ENS: 0.952
Length: 192.
Predicted Ligands:
lysine - 10/20
glucosamine - 5/20
cobalamin - 4/20
 RS: URS000232F9FB_1435356
MFE: -89.758
Ligand: cobalamin
Species: Rhodococcus pyridinivorans SB3094 Cobalamin riboswitch
 RS: URS0000BE99C8_4572
MFE: -59.865
Ligand: lysine
Species: Triticum urartu Lysine riboswitch
 RS: URS0000C5C361_1628856
MFE: -58.965
Ligand: lysine
Species: bacteria symbiont BFo2 of Frankliniella occidentalis Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115905 URS000232F9FB_1435356 URS0000BE99C8_4572 URS0000C5C361_1628856
Length 192. 193. 193. 193.
Similarity - 0.950 0.949 0.949
Ensemble Norm 0.952 - - -
MFE -45.315 -89.758 -59.865 -58.965
Ligands - cobalamin lysine lysine
Gene UBAP2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 7.001 7.001
Length SE - 1. 1. 1.
Lev Distance - 60. 63. 63.
UBS 15. 15. 16. 16.
BS 0. 0. 0. 0.
ILL 5. 6. 5. 5.
ILR 5. 6. 5. 5.
H 5. 3. 4. 4.
BL 4. 4. 5. 5.
BR 3. 5. 5. 5.
UN 0.068 0.052 0.041 0.041

Sequences

Field Description
UTR seq + 25 gggucggcccgacuaagugacuuaaacucccaccuacuccuggaauaaggagucaaagcccggauaggcgcaguauucuaccuuguaaauacuguuauuuguauauacuguaaaugaugacaucggugggcacuaaccgagcccggggaaacugggaacaaccucaaATGATGACATCGGTGGGCACTAACC
UTR dot + 25 .(((((…)))))..(((.((((…(((…((((((((……))))))…))…))))))))))…….(((…(((.((((……..)))).))).)))…((((.(((((.((((……..(..(((((…..)))))..)…))))..))))).))))(((……..)))
RS 1 seq CUACUCUCGGCUUGCCGUGGUGCUCGGGAAGCCGGUGGGAAACCGGCGCGGCCCUCGCCACUGUGAGCGGAUAGUUGCUCGCCCUCGUCCGUACCGGUCCGCCGGUGUGGAGGCCACUGGAUCUCAUCCGGGAAGGUCGGCGCAGCAGCGGUGACCCGUCAGCCAGGAGACCGGCCACGGCACGUGAGGUCCA
RS 1 dot ..(((.((.((((((.((((((…(((..((((((…..))))))….))).)))))).)))))).)).)))…..(((….((((((((((….)))))))))))))…(((((((((((((((..((((..(…((.((((….))))..))..)..))))..)).)))…))))))))))
RS 2 seq UGCACCAGAAGAGGCGCGUCACCCAGGCAGUAUGUCAGAGAAUCCGUAUUCAUUGACGGCAUAUCAGGGGGAGUGACGCCGAGACGAUAAACAUACGGGUUGUUUAUUUGUCGGCUACAGGGGCUGAAUCCCUUGAGUUGUCACCAAUACAUCAGUUGAUGUUAAUGACGUUAGGUGGGGGGCUUCUGAGUAG
RS 2 dot .((.((……)).))(((((((..(..((.((((((.((((….)))).))))))..))..)..)))…))))(((((.(.((((((((…….))))))))).)))))..((((((((…((((((((..(((((…..(((((….)))))…)))))))))).))).))))))))…..
RS 3 seq UGCACCAGAAGAGGCGCGUCACCCAGGCAGUAUGUCAGAGAAUCCGUAUUCAUUGACGGCAUAUCAGGGGGAGUGACGCCGAGACGAUAAACAUACGGGCUGUUUAUUUGUCGGCUACAGGGGCUGAAUCCCUUGAGUUGUCACCAAUACAUCAGUUGAUGUUAAUGACGUUAGGUGGGGGGCUUCUGAGUAG
RS 3 dot .((.((……)).))(((((((..(..((.((((((.((((….)))).))))))..))..)..)))…))))(((((.(.((((((((…….))))))))).)))))..((((((((…((((((((..(((((…..(((((….)))))…)))))))))).))).))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table