Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA115944 Similarity: 0.949 Similarity: 0.948 Similarity: 0.945
UTR: 5HSAA115944
Gene: UBAP2L_4
MFE: -40.934
ENS: 0.959
Length: 192.
Predicted Ligands:
cobalamin - 13/20
lysine - 5/20
TPP - 1/20
 RS: URS000232AD03_1245471
MFE: -62.569
Ligand: cobalamin
Species: Pseudomonas resinovorans NBRC 106553 Cobalamin riboswitch
 RS: URS000232F9FB_1435356
MFE: -89.758
Ligand: cobalamin
Species: Rhodococcus pyridinivorans SB3094 Cobalamin riboswitch
 RS: URS0002316172_683316
MFE: -83.960
Ligand: cobalamin
Species: Frankia sp. EI5c Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA115944 URS000232AD03_1245471 URS000232F9FB_1435356 URS0002316172_683316
Length 192. 193. 193. 192.
Similarity - 0.949 0.948 0.945
Ensemble Norm 0.959 - - -
MFE -40.934 -62.569 -89.758 -83.960
Ligands - cobalamin cobalamin cobalamin
Gene UBAP2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.003 8.002 7.
Length SE - 1. 1. 0.
Lev Distance - 64. 63. 70.
UBS 14. 16. 15. 15.
BS 0. 0. 0. 0.
ILL 5. 6. 6. 4.
ILR 5. 5. 6. 7.
H 4. 3. 3. 4.
BL 4. 4. 4. 4.
BR 3. 3. 5. 4.
UN 0.099 0.047 0.052 0.078

Sequences

Field Description
UTR seq + 25 cccgacuaagugacuuaaacucccaccuacuccuggaauaaggagucaaagcccggauaggcgcaguauucuaccuuguaaauacuguuauuuguauauacuguaaaugaugacaucggugggcacuaaccgagcccggggaaacugggaacaaccucaaaaccaaaATGATGACATCGGTGGGCACTAACC
UTR dot + 25 ………(((.((((…(((…((((((((……))))))…))…))))))))))…….(((…(((.((((……..)))).))).)))…((((.(((((.(((………(..(((((…..)))))..)……….)))…))))).))))(((……..)))
RS 1 seq AUAAUAGCGCCCUUCAUCGGUCGCUGGCGCUCACCUGACGAGCCCCGGCCUAAGAGGGAACACGGUCGAGCCGUGGCUGCCCCCGCAACUGUAAGCAGCGAGUCCAUGCAAUCCAGGCCACUGAAUUUUUCGGGAAGGCCGCACUGGAUGAUGACCUGCCAGCCAGGAGACCUGCCGAUGAAACCAGUCGCGU
RS 1 dot ……(..(((((….(((((..((.((((…….)))))))))))…)))))..)..((((…((.((((((……………((((((.((((((((……((((.(((((…)))))…))))))).)))))..))..)))))))))))).)))).((((((…….)))).))
RS 2 seq CUACUCUCGGCUUGCCGUGGUGCUCGGGAAGCCGGUGGGAAACCGGCGCGGCCCUCGCCACUGUGAGCGGAUAGUUGCUCGCCCUCGUCCGUACCGGUCCGCCGGUGUGGAGGCCACUGGAUCUCAUCCGGGAAGGUCGGCGCAGCAGCGGUGACCCGUCAGCCAGGAGACCGGCCACGGCACGUGAGGUCCA
RS 2 dot ..(((.((.((((((.((((((…(((..((((((…..))))))….))).)))))).)))))).)).)))…..(((….((((((((((….)))))))))))))…(((((((((((((((..((((..(…((.((((….))))..))..)..))))..)).)))…))))))))))
RS 3 seq UACAGUUCGUCCCGCCGUGGUGUUCGGGAAGCCGGUGUGGAACCGGUGCGGCCCUCGCCACUGUGAUCGGGAUGUCACCGGCCAGUCCCCGCCCGUCGGGGAGUCACUGGGCACCGGAAAACGUCGCCUGGGAAGGCGGCCGGUGACGCACCACCCGUCAGCCAGGAGACCGGCCACGGCACCCGCGAUCCG
RS 3 dot …….((((((((.((((((…(((..((((((…..))))))….))).)))))).)….)))))))…((((((((((((((…..))))))….))))…))))…..(((.(((((…(((((..((((…))))..)))))..))))).)))(((.(.(((…))).)..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table