Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116006 Similarity: 0.922 Similarity: 0.921 Similarity: 0.920
UTR: 5HSAA116006
Gene: UBAP2L_5
MFE: -59.314
ENS: 0.682
Length: 236.
Predicted Ligands:
cobalamin - 11/20
glucosamine - 4/20
FMN - 3/20
 RS: URS0000AB3C7D_717605
MFE: -112.013
Ligand: glucosamine
Species: Thermobacillus composti KWC4 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0002316B0F_434085
MFE: -61.662
Ligand: cobalamin
Species: gamma proteobacterium IMCC2047 Cobalamin riboswitch
 RS: URS0000C6BD13_1703387
MFE: -82.975
Ligand: glucosamine
Species: Anaerolineae bacterium SM23_ 63 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116006 URS0000AB3C7D_717605 URS0002316B0F_434085 URS0000C6BD13_1703387
Length 236. 236. 235. 235.
Similarity - 0.922 0.921 0.920
Ensemble Norm 0.682 - - -
MFE -59.314 -112.013 -61.662 -82.975
Ligands - glucosamine cobalamin glucosamine
Gene UBAP2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.003 10.003 29.016
Length SE - 0. 1. 1.
Lev Distance - 101. 99. 88.
UBS 16. 16. 16. 16.
BS 0. 0. 0. 1.
ILL 3. 4. 5. 8.
ILR 4. 6. 5. 5.
H 4. 4. 5. 4.
BL 4. 5. 4. 3.
BR 5. 5. 3. 4.
UN 0.174 0.119 0.115 0.047

Sequences

Field Description
UTR seq + 25 aagugggcgggggaaggcgcgagagcgagcgcgagagggaaaaggagggaggggguggggaagagggaaucuuauaucacgugacaggggcggcgcggcccggggugucaguguggaggagacugaguauucuaccuuguaaauacuguuauuuguauauacuguaaaugaugacaucggugggcacuaaccgagcccggggaaacugggaATGATGACATCGGTGGGCACTAACC
UTR dot + 25 …………….((((……..))))……………..(.(((((((((…..((..((((…((((((((((.((((……))))….))))).)))))))))..))…..))))))))).)……(((((((…………….)))))))..(((((((.((.(((((((((((…..)))))……..).))))))))).))).))
RS 1 seq CCAACGAUUCAAGCGCCAGAACUUGCGGGCCCGUGCUGCUGCCGGCCGUCAUCGUCAUCCGCGGGAAGCGGGGAUUUCGGCAUGGCGGUGCGGCGGCGAGGCGGGCGGCAAGUUGACGAGGCGGGGGUGUUCGAAGUUUUCGGCGGGGACCCUCCGGCUGCAUCCGUUCCAGCCGUCAAGCCGGGAAGGAAAACGACCGGGCGACCGGUCCGACAAAGGUCUCGGCAGAGCGGACC
RS 1 dot …………..(((.((((((((..((((((..((((((((((((((((.(((((((.((…..)).))))…))))))))))).))))))))..)))))).)))))))..)..)))((((((.((((..(….)..)))).))))))((((((.(…..).))))))….(((((((……..((((((….))))))………)))))))……….
RS 2 seq CAUUCCUGGACUGGAACAGGUGCCAGCGCUUCCAUCGCGAAGUCAGGAUAAUCGGGAAGUAUGGAUAGCGUGAUCGUUGAUCAUCAAUCCCAUCGCUGCCCCCGCAUCGGUAAUAAAGAGCUAUUUACAUAAGCCACUAGAUUUAAGUGAUCUGGGAAGGCGUAAAUCUUUCGGUUGGGUCGUAUUGGCGCAACCCUCUUUGAGCCCGAAGACCGGCCUGAUCUACCACUAAAAC
RS 2 dot …((((.(((((((…((((….))))))))…….)))))))…..(((.(((((((…..((((((…))))))…..)))).))).)))(((…)))…….(((..((((((….(((.(((((((…..)))))))…)))))))))..)))((((((((((….(((.(((……))).)))…….))))))))))…………
RS 3 seq UGGGGAGGAUCAGCGCAAGGCCCCGAGAUCAUCGGGGUGACGAGGACGAGGGUUCCCUACUGCGAGGUGGGGUCAACCGGAUAAUGCUGACGGCUCCCAACCGUCACACCGGGAAAAUCGAGAGAUCAGCGGAUGCCCUCCGGGCGUGCCACGGCCCGAAACUUCCCCUCCAUUAAAUCCUACAGGUAAUACCAUGUUGGUAACAGCGUGGACAAAACUGUUGGGAGUGGCGAUC
RS 3 dot .(((((((.((..((….(((((((…..)))))))..))..)).(((((((((…(((…..(.((…..((((….((.((((((…….))))))))))))…..)).)…..))).))).))))))(((((……..)))))…))))))).((((….((((((((……((((((((….))))))))……)))).))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table