Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116015 Similarity: 0.945 Similarity: 0.944 Similarity: 0.943
UTR: 5HSAA116015
Gene: UBAP2L_6
MFE: -56.926
ENS: 0.962
Length: 192.
Predicted Ligands:
cobalamin - 16/20
lysine - 2/20
FMN - 1/20
 RS: URS0002316490_935850
MFE: -65.829
Ligand: cobalamin
Species: Paracoccus sp. J56 Cobalamin riboswitch
 RS: URS00023239D1_1940691
MFE: -78.123
Ligand: cobalamin
Species: Desulfobacca sp. 4484_104 Cobalamin riboswitch
 RS: URS0002320CBE_491915
MFE: -53.761
Ligand: cobalamin
Species: Anoxybacillus flavithermus WK1 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116015 URS0002316490_935850 URS00023239D1_1940691 URS0002320CBE_491915
Length 192. 191. 191. 192.
Similarity - 0.945 0.944 0.943
Ensemble Norm 0.962 - - -
MFE -56.926 -65.829 -78.123 -53.761
Ligands - cobalamin cobalamin cobalamin
Gene UBAP2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.001 5.002 1.
Length SE - 1. 1. 0.
Lev Distance - 66. 71. 77.
UBS 13. 15. 14. 13.
BS 0. 0. 0. 0.
ILL 2. 3. 4. 2.
ILR 3. 5. 3. 3.
H 6. 5. 6. 6.
BL 4. 5. 4. 4.
BR 2. 3. 2. 3.
UN 0.130 0.094 0.084 0.115

Sequences

Field Description
UTR seq + 25 gagcagccguaggaagggggggccaugcggcuagagccugagaggggagagcgagaaagagcgcgagcgagcgaggccugggccuugccugaguauucuaccuuguaaauacuguuauuuguauauacuguaaaugaugacaucggugggcacuaaccgagcccgggATGATGACATCGGTGGGCACTAACC
UTR dot + 25 ….(((((((((………)).)))))))….(((….)))….(((((..((((.((..(.(.(((((((….)))))))))..)).))))..)))))……(((((((…………….)))))))(((((……..)))))(((((.((((….))))..)))))…….
RS 1 seq GCUUACUGAUGGGGUCAUGGUGAAUCCGGCCCCGGCCGGACGAAGAAGAGGGAAGCCGGUGAAAAUCCGGCACUGCCCCCGCAGCUGUAAGCGGCGAGCGACGCUGGAACACCACUGAGGCCCUGGCUUCGGGAAGGUCAGCCAAGCCGGGACCCGCAAGUCAGAAGACCUGCCAUGACACGAGAUGACGU
RS 1 dot .(((.(((.(((((((..((…..)))))))))..)))…)))………(((((((….((((((..(((.(((((……..)))).).)))..))))))….))))..)))((((((((.((………))))))))))….(((.(((….))).)))(((……..)))….
RS 2 seq GACAGGCGAGAGUUAGUCUGCGGGCCAGCCCGAGGUUGGCCAAGGAACCCGGUGAAAAUCCGGGGCGGUCCCGCCGCUGUGACCGGGGACGAAUCCGGCAAAAACCACUGCCUGGGCGCUUAACCCAGGUGGGAAGGGCCGGCGGAGAAAGAUCCGGGAGCCAGAAGACGAGCAGAUUGACUUGAGGGGAU
RS 2 dot (.(((((……..)))))).((((((((…))))))))…(..((((((…….((.((((((…)))))).))))))))..)….(((((…..((.(((((((((…….)))))))))…)))))))((((……))))….((..(((.(((…..))).)))..))….
RS 3 seq AUAUGUCCGUUGCAAAAAGGUGUCGAACGGGCAACCUAGUAGACUUAAUAGGGAAUCUGGUGCAAGGCCAGAACUGUCCCCGCAACUGUAAAUGCUGACGAAAUGAAACGUGCCACUGUACAAUUUGUACGGGAAGGCUUCAAAGUAGGAUGACGCAUAAGUCAGUAGACCUGCCUUUUUGCUUCGUCAUUC
RS 3 dot …(((((((((((……)))..)))))))).((((……….))))…((((((…..))))))..((((…(((……..))).))))…((((….(((.(((((((…)))))))…)))))))……(((((.(((.(((.(((…..))).)))..))).)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table