Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116071-1 Similarity: 0.979 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA116071-1
Gene: UBE2C
MFE: -34.478
ENS: 0.781
Length: 105.
Predicted Ligands:
SAM - 20/20 - 20/20


 RS: URS0000DB6311_1797678
MFE: -27.109
Ligand: SAM
Species: Clostridiales bacterium GWC2_40_7 SAM riboswitch (S box leader)
 RS: URS0000ABCA2C_340099
MFE: -33.585
Ligand: SAM
Species: Thermoanaerobacter pseudethanolicus ATCC 33223 SAM riboswitch (S box leader)
 RS: URS0000D8ACE2_1665556
MFE: -24.901
Ligand: SAM
Species: Bacillus sp. LL01 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116071-1 URS0000DB6311_1797678 URS0000ABCA2C_340099 URS0000D8ACE2_1665556
Length 105. 104. 105. 106.
Similarity - 0.979 0.978 0.977
Ensemble Norm 0.781 - - -
MFE -34.478 -27.109 -33.585 -24.901
Ligands - SAM SAM SAM
Gene UBE2C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 6. 1.011
Length SE - 1. 0. 1.
Lev Distance - 27. 28. 29.
UBS 7. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 0. 2.
ILR 1. 1. 0. 1.
H 4. 4. 4. 4.
BL 1. 1. 2. 1.
BR 2. 2. 2. 2.
UN 0.210 0.173 0.229 0.104

Sequences

Field Description
UTR seq + 25 gagccauugauuggucgacgcccccagaggguuacaauucaaacgcgggcgggcgggcccgcaguccugcaguugcagucATGGCTTCCCAAAACCGCGACCCAG
UTR dot + 25 ..((((…..))))….((((…..))))…………((((((……))))))….(((..(((((.((..(((….)))..)).))))).)))
RS 1 seq AUCUUAUCAAGAGAGGUGGAGGGACUGAGCCCUAUGAAACCCGACAACCGGCCUGAUGGCACGGUGCCAAUUCCUGCAGGAGAAUUAUUCCUGAGAGAUGAGUA
RS 1 dot .((((…..))))(((..((((……))))…..)))…..(((((((….))).))))……((((.((((((…..)))))))).))……
RS 2 seq CUCUUAUCAAGAGAGGUGGAGGGAAAGAGCCCGAUGAAACCCAGCAACCUGUCCUAUAGGACAAGGUGCUAAUUCUCUCAGAAGCAUGCUUCUGAAAGAUGAGGG
RS 2 dot (((((…..)))))…..(((……)))……….(((.((((((((….))))).))))))…(((.(((((((….))))))).)))……
RS 3 seq UUCUUAUCAAGAGAGGUGGAGGGACUGGCCCUAUGAAACCCGGCAACCGUACUGACAAUAGUAUAGGUGCCAAUUCCAGCAAGACAAACGUUCUUGGAGAUAAGUG
RS 3 dot .((((…..))))(((..((((…..))))…..))).(((.(((((((((….)))))).))))))..((((((…(((….))).))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table