Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116132 Similarity: 0.975 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA116132
Gene: UBE2F
MFE: -43.063
ENS: 0.767
Length: 116.
Predicted Ligands:
methionine - 14/20
SAM - 3/20
glycine - 2/20
RS: URS0000ABB0D7_1073574
MFE: -49.202
Ligand: methionine
Species: Gordonia araii NBRC 100433 S-adenosyl methionine (SAM) riboswitch,
RS: URS0000D6A8A7_12908
MFE: -26.266
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
RS: URS0000C02553_1736349
MFE: -42.454
Ligand: methionine
Species: Williamsia sp. Leaf354 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116132 URS0000ABB0D7_1073574 URS0000D6A8A7_12908 URS0000C02553_1736349
Length 116. 116. 115. 116.
Similarity - 0.975 0.973 0.972
Ensemble Norm 0.767 - - -
MFE -43.063 -49.202 -26.266 -42.454
Ligands - methionine cobalamin methionine
Gene UBE2F - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 10.013 12.011
Length SE - 0. 1. 0.
Lev Distance - 31. 31. 33.
UBS 8. 9. 7. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 3.
ILR 1. 1. 2. 2.
H 3. 3. 3. 3.
BL 2. 3. 2. 3.
BR 4. 2. 2. 5.
UN 0.129 0.086 0.243 0.026

Sequences

Field Description
UTR seq + 25 gcgucucgcagcagccgcccggaccgggcaugguguugggcgccgggcccgccucgccugucucggggagcccaggguaaaggcagcaguaATGCTAACGCTAGCAAGTAAACTGA
UTR dot + 25 ((((((.(((.((…(((((…))))).)).))).)))))).((((…(((((…….))))).))))………….((((..(((((….)))))…..)))).
RS 1 seq GGUCCAGAGCGUCAGCGCGAAGUCCCGGCUCGCUGACCGGCAACCCUCCAACCGCGGUGGGGUGCUCCGGGGUGAUGACCUGGUCGUGCGGAAACGCCGCACGGCAAGCGCGGGUC
RS 1 dot ((((…((((..(((.((……)))))))))))))((((.(((.((……)).))).))))……….(((((((((((((((…..)))))))))…..))))))
RS 2 seq CAUUUGAAGUAGGGAAAAUUCUGUAAAUUCAGAUACUACACCCGUAACGGUUAAAAGUCCGAACGCCUACAAGAAAUGAUGCCCAUGAAGCGGGGAGGCUUCAUAAGAUGGGAAA
RS 2 dot .(((((((.((.(((….))).))..)))))))……..(((..(((……..))).)))…………….((((((((((……))))))…..))))…
RS 3 seq GGUCAUGAGUGUCAGCGCACAGCCCCGGCUUGCUGACCGGCAACCCUCCAACCGCGGUGGGGUGCUCCGGGUGACGACCAGGCCGCGUCCGAGGUGGACGUGUGCAAGCGCGGACU
RS 3 dot ((((((((((….((…..))….))))).))))).(((.(((.((……)).))).)))((((.(…….(..(((((((((…..))))))).))..)).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table