Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116134 Similarity: 0.959 Similarity: 0.956 Similarity: 0.953
UTR: 5HSAA116134
Gene: UBE2F_0
MFE: -34.132
ENS: 0.957
Length: 158.
Predicted Ligands:
cobalamin - 6/20
FMN - 4/20
TPP - 3/20
 RS: URS0000C60854_1513271
MFE: -28.331
Ligand: molybdenum
Species: Catenovulum maritimum Moco (molybdenum cofactor) riboswitch
 RS: URS0000C5FDFA_29343
MFE: -42.326
Ligand: Mg2+
Species: Clostridium cellulosi M-box riboswitch (ykoK leader)
 RS: URS00023303C3_1971635
MFE: -32.472
Ligand: cobalamin
Species: Tenericutes bacterium 4572_104 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116134 URS0000C60854_1513271 URS0000C5FDFA_29343 URS00023303C3_1971635
Length 158. 159. 155. 160.
Similarity - 0.959 0.956 0.953
Ensemble Norm 0.957 - - -
MFE -34.132 -28.331 -42.326 -32.472
Ligands - molybdenum Mg2+ cobalamin
Gene UBE2F - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.005 14. 7.002
Length SE - 1. 9. 4.
Lev Distance - 50. 41. 55.
UBS 9. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 6. 5. 4. 6.
ILR 1. 3. 3. 2.
H 2. 1. 2. 1.
BL 1. 2. 3. 3.
BR 3. 2. 4. 3.
UN 0.152 0.220 0.161 0.106

Sequences

Field Description
UTR seq + 25 guuaccgaaaugcugccuuagagcguaauuugcaggaaagaggaaguuuuguuuuaaaccagaucuucaagaguugaagcauauugaagaaggaaaagaauucugaagcaacugcaggguaaaggcagcaguaATGCTAACGCTAGCAAGTAAACTGA
UTR dot + 25 ……….(((((((((…((….(((((((……((((…((.((((…((…(((((((………….))))))).)))))).))))))…….))))))))).)))))))))….(((((….)))))……….
RS 1 seq AAAAAUUUAAAACUCCGAGCUUCUCCGCCUAAGUCUUGCAUAAGUUGUCAGUUUGAUAUGGUUGUUUGGCCGCUAGUGAAUCAUGUAUUAACUAGCCAGGGUUCAAUCAGAAAUUGAUUUAGCCUCCCUUACUUGGAAAGGUGUUUAAUGUUAAAAGAU
RS 1 dot ………………((((.((((..((((….((.(((…((((((((….((((((…((((((((((………….))))))…)))))))))).)))))))))))))….))))..)))).))))……………..
RS 2 seq UAAAUCUCUCGGUAGGUGAGGUUACUUAAAGGAUAUGGAUUGAUGCCGUGAAGAGCUGGAGACAGUUCCAACUGGUUAACAGGUUUCGCCGUAUUAAGGCGUAACCCAUUUCAAUUUCACCGCCUUUAAGUGCUAAAACUCGUACGAGCAGUAUC
RS 2 dot ……….(((.(((((((((…….((.((((..(((((((.((((((..(((..((((((….)))).))..))).)))))).)))))))..)))).))……))))))))))))…..((((……..))))……….
RS 3 seq UAACUUAGCUAGUAAAUAGGUGUAUAACAGGGAAGCAGGUGAGAUUCCUGGACUGUACCAGCAACCGUGAAUCGGAUGUCUAUUCAUAAACCAUCGGAAACGAGAAGGAGAAUAGAUAGAUGAAGGAAGUCGGGAGACCUACCUAUUUAUUAAAUACAUU
RS 3 dot ………((((((((((((……………((((….(((((.((((…((..((.(………..(((((((((…..((.(((….)))…)).)))))))))).))..)).)))))))))))))))))))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table