Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116281 Similarity: 0.986 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA116281
Gene: UBE3A
MFE: -16.142
ENS: 0.795
Length: 69.
Predicted Ligands:
cobalamin - 13/20
fluoride - 7/20

RS: URS0000AB7DFD_1302244
MFE: -24.705
Ligand: cobalamin
Species: Propionibacterium acnes JCM 18920 Cobalamin riboswitch
RS: URS0000D86E82_1848
MFE: -27.937
Ligand: cobalamin
Species: Pseudonocardia thermophila Cobalamin riboswitch
RS: URS0000C40E2E_1133569
MFE: -11.509
Ligand: fluoride
Species: Lactobacillus vini DSM 20605 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116281 URS0000AB7DFD_1302244 URS0000D86E82_1848 URS0000C40E2E_1133569
Length 69. 69. 68. 70.
Similarity - 0.986 0.985 0.984
Ensemble Norm 0.795 - - -
MFE -16.142 -24.705 -27.937 -11.509
Ligands - cobalamin cobalamin fluoride
Gene UBE3A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.010 5.003 7.020
Length SE - 0. 1. 1.
Lev Distance - 15. 17. 18.
UBS 6. 8. 5. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 1. 1. 0.
H 2. 2. 2. 2.
BL 3. 4. 3. 2.
BR 2. 4. 0. 1.
UN 0.188 0.087 0.132 0.329

Sequences

Field Description
UTR seq + 25 acagaucaggagaaccucagucugacgacauugaagcuagccgaATGAAGCGAGCAGCTGCAAAGCATC
UTR dot + 25 .(((((.(((….)))..)))))……(((.((((.((((…….)).)))))).)))……
RS 1 seq GGGAAGCUGGUGGGAGUCCGGCACUGUCGCGCAACCGUGACCACCAUUGUGUGUGGGAGUCGGGGUACC
RS 1 dot (.((((.((.(((….))).)))).)).)…(((.((((..((((…..))))..)))).)))…
RS 2 seq GGGAACCCGGUGCGAAUCCGGGACGGUCCCGCCACUGUGACCGGACGCCAGGUCCGGCGAGUCAGACC
RS 2 dot ((((.(((((…….)))))….))))…(((.((.((((((…..)))))))))))……
RS 3 seq UGAAAUAAAGGUGAUGACGUUCACCUAUUAAAUGAUCGUAAGCAAAUGACCUGAUGACGUCUACUAAACU
RS 3 dot ……..((((((……))))))…..(((.((((.((……..)).)))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table