Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116393 Similarity: 0.972 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA116393
Gene: UBL5
MFE: -49.906
ENS: 1.
Length: 129.
Predicted Ligands:
guanidine - 7/20
molybdenum - 4/20
glycine - 4/20
 RS: URS0000D65B78_272564
MFE: -48.955
Ligand: molybdenum
Species: Desulfitobacterium hafniense DCB-2 Candidate Moco riboswitch
 RS: URS0000C4BEAF_1134474
MFE: -42.637
Ligand: guanidine
Species: Cellvibrio sp. BR Guanidine-I riboswitch
 RS: URS0000D8A306_1977880
MFE: -32.231
Ligand: guanidine
Species: Acinetobacter sp. ANC 4218 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116393 URS0000D65B78_272564 URS0000C4BEAF_1134474 URS0000D8A306_1977880
Length 129. 129. 130. 130.
Similarity - 0.972 0.969 0.968
Ensemble Norm 1. - - -
MFE -49.906 -48.955 -42.637 -32.231
Ligands - molybdenum guanidine guanidine
Gene UBL5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.009 12. 9.
Length SE - 0. 1. 1.
Lev Distance - 34. 36. 39.
UBS 8. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 0. 2. 1. 2.
ILR 2. 2. 2. 3.
H 3. 4. 3. 3.
BL 3. 3. 4. 3.
BR 3. 3. 4. 3.
UN 0.147 0.054 0.138 0.154

Sequences

Field Description
UTR seq + 25 aacuuccgcuuccgguuccuagcguuaacugcgaccgggguucagcgcucgggugaggagcugguggcgucggcagguucgaggcgauucgagcuccagcuaggATGATCGAGGTTGTTTGCAACGACC
UTR dot + 25 ……((((.(((((((((((((((((((.(….).)))).))))))……))))))))).))))..(((.((((((((….))))))))…)))………..(((((((…)))))))
RS 1 seq AAUAGUGAAAUCUUUCGAAUCGUUUCCCGCUAAAGCCAUGCUAUGCGGGGGCGAUCUGAGCAAAGGCUCACAGGGUCGGCAUAGAAAUGUACCGGCCUCCCGCAAAGGGGUAUCCUGUCUGGGAUGCCU
RS 1 dot ….((((..(((((((.((((.(((((((…(((…)))..))))))))))).)))…)))).)))).(((((((.(((….))).))))))).((…..))((((((((….)))))))).
RS 2 seq UAAAUAGAGAGCUAGGGUUCCGGUCAUUCGAUUAAUCAUCCAAUGAUGUCUGGUCCGAGAGCUUUCGACCUCUGCCGCCAGACCUUCUGGCAGGUCAUGGGUUACACGGCGGGACAAAAGCCCGGGAGAU
RS 2 dot ……(((((((.(((..(((((((((.(((…..))).)))))…)))))))…)))))))(((((.((((((((((…)))))).)).)).)))))……((((.(….)))))……
RS 3 seq CAUAAAGUGAUCUAGGGUUCCGGCAGUUAUUUGGGCAGUUAUUUGCAAAAAUACUGUGUCUGAGACCGAGAGUUCACGGCUUAGUUUUGAUAAAAACAGAGCUACACGGAGGGAUAAAAGCCCGGGAGGU
RS 3 dot ……(((((((..((((.((((((.(((((..((((….))))..))))))))…))).)))).)))..))))(((((.(((((….))))).)))))…….(((…….)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table