Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116565 Similarity: 0.986 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA116565
Gene: UCHL1_0
MFE: -13.017
ENS: 0.708
Length: 54.
Predicted Ligands:
glutamine - 16/20
unknown - 3/20
SAM - 1/20
 RS: URS0000C79874_12908
MFE: -11.166
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C62AB3_1822225
MFE: -13.810
Ligand: SAM
Species: Oceanibulbus sp. HI0023 SAM/SAH riboswitch
 RS: URS0000C113AF_12908
MFE: -8.025
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116565 URS0000C79874_12908 URS0000C62AB3_1822225 URS0000C113AF_12908
Length 54. 52. 53. 55.
Similarity - 0.986 0.985 0.985
Ensemble Norm 0.708 - - -
MFE -13.017 -11.166 -13.810 -8.025
Ligands - glutamine SAM glutamine
Gene UCHL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 1.018 8.
Length SE - 4. 1. 1.
Lev Distance - 14. 19. 17.
UBS 4. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 2. 1. 1. 3.
H 2. 1. 2. 1.
BL 0. 0. 0. 2.
BR 0. 1. 0. 1.
UN 0.037 0.038 0.170 0.036

Sequences

Field Description
UTR seq + 25 aggcuauuucugccgggcgcuccgcgaagATGCAGCTCAAGCCGATGGAGATCA
UTR dot + 25 .((((….((((….(((…)))…..))))….))))(((….))).
RS 1 seq AUCGUUCAACCCUUUUUGGGUCGGAAGUAAGCUUCAGCUGAAGGAACGCGAA
RS 1 dot .((((…..(((((…(((..((((….)))).))))))))…)))).
RS 2 seq CGCUUGCCACAACGGCUUCCUGACGUGGCAAUUAACGCAUUUCAAUCGGAGCA
RS 2 dot …(((((((..(((….)))..)))))))…..((..(((….))))).
RS 3 seq AUCGUUCAAUCCUUUUUAGGGGUCGGAAGUAGGUAUCAUACUGAAGGAACGCGGA
RS 3 dot .((((….((((((.((.((..(……..)..)).))..))))))..)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table