Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA116951 Similarity: 0.986 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA116951
Gene: UNC5D
MFE: -14.491
ENS: 0.977
Length: 81.
Predicted Ligands:
zmp-ztp - 9/20
cobalamin - 8/20
fluoride - 1/20
 RS: URS0000DAFD6A_1904969
MFE: -38.080
Ligand: cobalamin
Species: Saccharomonospora sp. CUA-673 Cobalamin riboswitch
 RS: URS0000C6F5A8_1736350
MFE: -28.969
Ligand: zmp-ztp
Species: Sphingomonas sp. Leaf357 ZMP/ZTP riboswitch
 RS: URS0000D8CE7B_1450648
MFE: -18.380
Ligand: zmp-ztp
Species: Clostridium oryzae ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA116951 URS0000DAFD6A_1904969 URS0000C6F5A8_1736350 URS0000D8CE7B_1450648
Length 81. 82. 81. 81.
Similarity - 0.986 0.986 0.985
Ensemble Norm 0.977 - - -
MFE -14.491 -38.080 -28.969 -18.380
Ligands - cobalamin zmp-ztp zmp-ztp
Gene UNC5D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.001 10.002 9.001
Length SE - 1. 0. 0.
Lev Distance - 13. 16. 17.
UBS 6. 8. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 0. 1. 2. 2.
H 2. 2. 2. 2.
BL 3. 2. 1. 2.
BR 2. 5. 2. 0.
UN 0.099 0.073 0.148 0.074

Sequences

Field Description
UTR seq + 25 uuaaauaaguagggauuguuuaaaaaaaaaagcuguaauauguuaucuggggguggATGATCCTGGTGTTAGTTAAAGCTC
UTR dot + 25 ((((((((…….))))))))…….((((.((((.((.((((..(((((…..))))))))).)))))).)))).
RS 1 seq GUCCGGUGCGAAUCCGGCGCUGUGCCGCAACUGUGAUGCCCUCGCGGCGCCCCUCCGGGCGCGGUCGGAAGGGCGAGUCAGG
RS 1 dot ((.((((((…….)))))).))…..((((..(((((((((.((((((….)))))).).))..)))))).).))).
RS 2 seq UACCGGUCGCGUGACUGGCGAAUCGUGGGGCACCACAGGGAAGCGCCGACCAUAAUCGAGCCGUUCGCCUGGGCACCUUCA
RS 2 dot ..((((((….))))))……..((((..((.(((((((..(((((……))).))..))).))))))..))))..
RS 3 seq UUUUGAUCAUAUGACUGGCGGAAAUGGAGUUUACCAUAGGGAGUAUGAUUGAUUAAAUUAUCGACCGCCUGGGUAAAUUAU
RS 3 dot (((((.(((……))))))))….((((((((.((((..((((((((…..))))))..))..))))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table