Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117188 Similarity: 0.962 Similarity: 0.961 Similarity: 0.958
UTR: 5HSAA117188
Gene: UQCRC2
MFE: -52.107
ENS: 0.881
Length: 161.
Predicted Ligands:
TPP - 10/20
molybdenum - 3/20
glucosamine - 2/20
 RS: URS0000C19EA5_253628
MFE: -54.981
Ligand: TPP
Species: Ochroconis gallopava TPP riboswitch (THI element)
 RS: URS0000DB306F_106004
MFE: -59.705
Ligand: TPP
Species: Leucosporidiella creatinivora TPP riboswitch (THI element)
 RS: URS0000C018B7_36847
MFE: -42.979
Ligand: glucosamine
Species: Clostridium neopropionicum glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117188 URS0000C19EA5_253628 URS0000DB306F_106004 URS0000C018B7_36847
Length 161. 159. 161. 159.
Similarity - 0.962 0.961 0.958
Ensemble Norm 0.881 - - -
MFE -52.107 -54.981 -59.705 -42.979
Ligands - TPP TPP glucosamine
Gene UQCRC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 18.003 9.002
Length SE - 4. 0. 4.
Lev Distance - 40. 44. 47.
UBS 11. 11. 13. 10.
BS 0. 0. 0. 0.
ILL 5. 8. 6. 4.
ILR 4. 4. 4. 3.
H 3. 2. 3. 2.
BL 1. 1. 3. 3.
BR 1. 0. 4. 2.
UN 0.112 0.132 0.056 0.151

Sequences

Field Description
UTR seq + 25 gcggcaguauagagaguaccucacgaaggggacgugggaaaguguuagcggggaacgcugggaaacucccggccuccgccaccaucuugcuuuccuuuaauccggcagugaccgugugucagaacaaucuugaaucATGAAGCTACTAACCAGAGCCGGCT
UTR dot + 25 ………..(((…..)))..((((((((.((((((..(((…((((((…(((((((…))))))))))))))))..))))))))))))))…(((((((((..((((..(((((….))).))..))))….))))…….)))))..
RS 1 seq UUCAUGGCACGCGGGUGUCCUGUUGCCAUAGAUCCUUCUAUUCUGCCAUAUCAGCCGCCUUUUGGUGGGAGGCGUUCAGAAGGGCGGCGACAGGGCUGAGAUCAUACCGCUGAACUUGAACGCUAUCAUGAGCGCGUAAGGAGAGCUAUGAAGUCCUAA
RS 1 dot …………….(((((((((((…(.(((((((….((((…((..(((((….)))))))))))…))))))))))))))))))).((..(((((..(((…((((..((((……))))..))))…))))))))..))….
RS 2 seq GCAUUGUCACACGGGUGCCCUUGCUGGUCUUCCUGGCCCAUCUCCCAAGGCUCAGCGCGAGCGAGGCCAAAGGAGAGGGUUGGGAGCAGGCUGAGGGCUGAGAUUAAACCGUCGAACUUGAACGUCUUCAGUGGCGCGUAAGAAGUGACAUGAUUUGAGGG
RS 2 dot …….(((….)))((((((((.((..(((((((((.(((((…((((..((….))..))))…)))))))))))))))).))).)))))((.((((((….((((..((((..((((……))))..))))…)))).)))))).))..
RS 3 seq UUGAAAAAUGAAGCGCCAGAACCGCAGAUAGGGCGGUUGACGAGGUAGAAGUGAUCGAAUUUUUCGGCGGAUGCUUCUCGCCCAUUCGUUCAGGGACGCAGGUCUUUCUACAAAUAGGAGAAGGUAAUUCUUCUGACAAAGGGAAAGGCAACGGACGAA
RS 3 dot …………(((((.((((….(((.((((((…..((((((….((.(((((…)))))))..))))))))))))))).))))..)).)))..((((((((…..((((((((…..))))))))……))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table