Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117210 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA117210
Gene: UQCRH
MFE: -25.255
ENS: 0.948
Length: 84.
Predicted Ligands:
guanidine - 11/20
zmp-ztp - 4/20
cyclic-di-GMP - 3/20
RS: URS0002334218_1660131
MFE: -32.036
Ligand: cobalamin
Species: Pseudonocardia sp. SCN 72-86 Cobalamin riboswitch
RS: URS0000ABB5B9_536227
MFE: -11.964
Ligand: cyclic-di-GMP
Species: Clostridium carboxidivorans P7 Cyclic di-GMP-II riboswitch
RS: URS0000D68021_12908
MFE: -25.321
Ligand: cyclic-di-GMP
Species: unclassified sequences Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117210 URS0002334218_1660131 URS0000ABB5B9_536227 URS0000D68021_12908
Length 84. 85. 84. 84.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.948 - - -
MFE -25.255 -32.036 -11.964 -25.321
Ligands - cobalamin cyclic-di-GMP cyclic-di-GMP
Gene UQCRH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 4. 4.
Length SE - 1. 0. 0.
Lev Distance - 20. 21. 21.
UBS 7. 7. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 2.
ILR 1. 1. 2. 2.
H 2. 2. 2. 2.
BL 2. 1. 2. 1.
BR 3. 4. 2. 2.
UN 0.119 0.118 0.131 0.131

Sequences

Field Description
UTR seq + 25 cugaacuggguuaggugccgcuguugcugcucguguugaaucuagaaccguagccagacATGGGACTGGAGGACGAGCAAAAGA
UTR dot + 25 …(((.((((…..))).).)))..(((((((.(….(((((..((((……..))))..)))))).)))))))…..
RS 1 seq GGAAGUCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCACGAACGCCCACUCGGUGAUCCGGGAGCCAGGAGAC
RS 1 dot ……((((…….))))(..(((((((…..((((((((((.((……)).).))))))))).))))).))..)….
RS 2 seq UAUGUCUUGGGAAAUUAUGAGCUAUAUACUUAAUUUGGGCACUUUGUAUAUAGGGAGUUAUUAGUGCAACCGGCCGAAUAUUUA
RS 2 dot ((((.((((……..)))).))))……((((((.(…((((((((((….))))..))))))..).))))))…..
RS 3 seq UAGUGGGGUAGAGGCUAAGAACUUCGUCCUGUAUGUGGGCACCUGGGGCGAAGGAAGCCAAUGGUGCGACCGCCUACCGUUUAA
RS 3 dot ….((((..((((…….)))).))))(((.(((((((((…(((…….)))…)))))..)))).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table