Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117211 Similarity: 0.952 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA117211
Gene: UQCRH_0
MFE: -55.113
ENS: 0.944
Length: 180.
Predicted Ligands:
cobalamin - 17/20
lysine - 2/20
SAM - 1/20
 RS: URS000232C4FE_1230342
MFE: -30.663
Ligand: cobalamin
Species: Clostridium tetanomorphum DSM 665 Cobalamin riboswitch
 RS: URS000233352E_1543706
MFE: -45.869
Ligand: cobalamin
Species: Halobacillus sp. BBL2006 Cobalamin riboswitch
 RS: URS0002330024_1121335
MFE: -58.336
Ligand: cobalamin
Species: [Clostridium] stercorarium subsp. stercorarium DSM 8532 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117211 URS000232C4FE_1230342 URS000233352E_1543706 URS0002330024_1121335
Length 180. 181. 181. 181.
Similarity - 0.952 0.951 0.951
Ensemble Norm 0.944 - - -
MFE -55.113 -30.663 -45.869 -58.336
Ligands - cobalamin cobalamin cobalamin
Gene UQCRH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.001 8.001 12.
Length SE - 1. 1. 1.
Lev Distance - 56. 60. 58.
UBS 13. 11. 14. 15.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 3.
ILR 1. 3. 3. 2.
H 7. 5. 6. 6.
BL 3. 2. 4. 5.
BR 3. 2. 3. 4.
UN 0.139 0.171 0.116 0.127

Sequences

Field Description
UTR seq + 25 aaucugagcauguguucgcgaccacgaugagugugccgcacuuccggccagaucgccggauuuccgcugagugacccuuacaaguccuucuugauccugaacuggguuaggugccgcuguugcugcucguguugaaucuagaaccguagccagacATGGGACTGGAGGACGAGCAAAAGA
UTR dot + 25 …..((((….))))(((.((((…..))).).)))…((((((……))))))……..(((.(((……..))))))((((((((……))))))))….((….))(((((((.(….(((((..((((……..))))..)))))).)))))))…..
RS 1 seq AUACAUAAAUUUUAGUAUAAAGUUUGUCAUUAAGACAAUAGGGAAUGAGGUGUAAAUCCUCAACGGUCCGGCCACUGUAAUUGGUGAGCUUAUUCCAAAAUGCCAUUGAGAAUAUUCUUGAGAAGGCGGAAGAAAGUGAUGAACCAAAAGUCAGGAUACCAUUUUUAAAUGUUUUUCAACA
RS 1 dot …………………..(((((…..)))))…(((.(((((…….)))))….)))((((((((….))))).)))((((((((…….))).)))))…(((((((.(((…(((((((…..((……..))….)))))))…))))))))))..
RS 2 seq UUCAUACGUAAGGAUGUUGGUGCCUGAGUAAGGCUUAAAAGGGAAUCUGGUUAGAAGCCAGAACUGUCCUCGCAACUGUAUGUGUUGACGAAAAGGAAGCUCCACUGUGCGAAAUGCAUGGGAAGGAUCCUAAGUAGGCAGACGCACAAGUCAGUAGACCUGCCAAAUCCUAUGUUUCAAA
RS 2 dot .(((.((((….))))))).((((…..))))…….(((.(((((((…)))))))….)))(((((((…….)))).)))..((((..((.(.((((((…..))))))).))..))))..(((((…..(((…(((….))).)))…..)))))……..
RS 3 seq CUACAUAUUGUUAUUACAGGUACUGCCUUGCGGCAGUUUAAAAGGGAAGCAGGUGAAAAUCCUGCACGGUCCCGCCGCUGUGAUGGGGAGGCAUCCCAUAACGUGCCACUGGGGAAUCCCGGGAAGGAAUGGGGUGUUGAUGAACCAGAGUCAGAAGACCUGCCUGUAAUGCCGCACCGUA
RS 3 dot …….((((….))))..((((((….))))))……((((.(((((…….)))))….))))…(((((.((((((…..)))))).))).))(.(((((….))))))..((..((.(((((((..(…(((.(((….)))))).)..))))))).))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table