Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117212 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA117212
Gene: UQCRQ
MFE: -34.119
ENS: 0.996
Length: 99.
Predicted Ligands:
glycine - 15/20
TPP - 2/20
fluoride - 1/20
 RS: URS0000DAAE19_398512
MFE: -26.384
Ligand: glycine
Species: Bacteroides cellulosolvens ATCC 35603 Glycine riboswitch
 RS: URS0000D8C975_1780378
MFE: -22.118
Ligand: glycine
Species: Clostridiales bacterium CHKCI001 Glycine riboswitch
 RS: URS0000DA935D_48256
MFE: -29.364
Ligand: glycine
Species: Clostridium hungatei Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117212 URS0000DAAE19_398512 URS0000D8C975_1780378 URS0000DA935D_48256
Length 99. 100. 97. 98.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.996 - - -
MFE -34.119 -26.384 -22.118 -29.364
Ligands - glycine glycine glycine
Gene UQCRQ - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 7.003 2.001
Length SE - 1. 4. 1.
Lev Distance - 22. 20. 26.
UBS 6. 6. 7. 6.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 2.
ILR 1. 3. 1. 1.
H 2. 2. 2. 3.
BL 1. 1. 3. 1.
BR 2. 0. 3. 2.
UN 0.232 0.260 0.289 0.265

Sequences

Field Description
UTR seq + 25 cuugccggaaaugacgaacgagucaaccggaucggugacuguggagggcgagcugagcccuggccgccgccacaATGGGCCGCGAGTTTGGGAATCTGA
UTR dot + 25 ….((((…((((……)))).))))..((((…(((((..((((.((((…..)))))))).)))))….))))……………..
RS 1 seq GGACGCACCUCUGGAGAGACCGUCAAGGCGCCGAAGGGGCAAGUUCGCCACAGAUAAUGUGGGAAUAUAAUCUCUCAGGCAAAAGGACAGAGUUAAAAGU
RS 1 dot .((((…(((….)))..))))…..(((..(((((…((((.(((((…..)))))))))….)))))..)))………………..
RS 2 seq UAAAACCACUCUGGAGAGUCUCCGAUUGGAGCGCCGAAGGUGUAACACAAGAAAGAAUUCUUGUCUAUCUCUCAGGCAAAAGGACAGGGCAUAAAUA
RS 2 dot …..(((.((.((((…)))))).)))…(((..(((.(((..(((((((….))))))).))).)))..)))………………..
RS 3 seq UAGCUGCUCUCUGGAGAGUCCCAUUUUUGGGCGCCGAAGGUGCAAGGAAAGGCGUACUGCUUUUCCGGUCUCUCAGGCAAAAGGACAGAGCUAUCAGA
RS 3 dot …..(((((….)))))((((….)))).(((..(((.((..((((((((…..)))))))).)).)))..)))………………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table