Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117498 Similarity: 0.968 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA117498
Gene: USP30
MFE: -56.630
ENS: 0.813
Length: 129.
Predicted Ligands:
TPP - 8/20
cobalamin - 4/20
SAM - 3/20
 RS: URS0000D80117_1519565
MFE: -31.148
Ligand: TPP
Species: Fistulifera solaris TPP riboswitch (THI element)
 RS: URS0000D7CBD6_1519565
MFE: -31.531
Ligand: TPP
Species: Fistulifera solaris TPP riboswitch (THI element)
 RS: URS00023167D7_256318
MFE: -69.273
Ligand: homocysteine
Species: metagenome sequence S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117498 URS0000D80117_1519565 URS0000D7CBD6_1519565 URS00023167D7_256318
Length 129. 129. 129. 131.
Similarity - 0.968 0.968 0.967
Ensemble Norm 0.813 - - -
MFE -56.630 -31.148 -31.531 -69.273
Ligands - TPP TPP homocysteine
Gene USP30 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.003 12.001 6.
Length SE - 0. 0. 4.
Lev Distance - 39. 37. 36.
UBS 12. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 1. 3. 3. 0.
H 2. 1. 1. 2.
BL 5. 4. 4. 5.
BR 6. 6. 5. 6.
UN 0.101 0.047 0.070 0.099

Sequences

Field Description
UTR seq + 25 ugcggccgcagguuccgcugucucgggaaccgucguaucccucgguccggcggcggcggcggcgguagcggaggagacgguuucaggccuccggugcggcugcaATGAAGAACTGGGGAGTTATAGGTG
UTR dot + 25 ((((((((((….(((..((((..(((((((((.(.((((((.(.(((.((….)).)))).).)).))).).)))))))))))))…)))))))))))))……((((….))))…….
RS 1 seq UACUCUCACCGCGGGAGCUUUGUGAUGUGGGUAAUGGCUGAGAAAUUAAAAGAGUCGGAAGAUUCUUUGUUGACCGUUCGAACCUGAACAUGGUAAUGCAUGCGAAAGGGAAGGUGAGAUGUGUCAUGG
RS 1 dot (((((((((((((…((.((((.(((((((((((((.(((.(……(((((((….)))))))).))).)))))…))))..)))).)))).)).)))………))))))).)))……
RS 2 seq CACUUUUGCCGCGGGAGCUUUGUGAUGUGGGUAAUGGCUGAGAAAUUAAUGGAGUCGAAAGAUUCUUUGUUGACCGUUCGAACCUGAACAUGGUAAUGCAUGCGAAAGGGAAGGCAAAAGUAUUAUGAA
RS 2 dot .((((((((((((…((.((((.(((((((((((((.(((.((……((((((….)))))))).))).)))))…))))..)))).)))).)).)))………)))))))))……..
RS 3 seq CCUCCCACCGAGGAGCGCUGCAACCCCAUUAUUAAAUCGGCACCUGCGGUCGGGUUUCGACCACAGGUGCCGAUUUAGUCGCGGGGCCAGGCUCGGUGAGGAGGUAUCUUCAACGACGGCGCUCACUCUGA
RS 3 dot (((((((((…((((.(((…((((.(.((((((((((((((((.(((((…..))))).)))))))))))))))).).)))).))))))))))).)))))…………(((.(….).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table