Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117502 Similarity: 0.976 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA117502
Gene: USP30_0
MFE: -50.397
ENS: 0.843
Length: 119.
Predicted Ligands:
SAM - 8/20
guanidine - 4/20
homocysteine - 3/20
 RS: URS00004AA15C_216591
MFE: -47.287
Ligand: guanidine
Species: Burkholderia cenocepacia J2315 Guanidine-I riboswitch
 RS: URS0000AB6566_1348852
MFE: -46.487
Ligand: guanidine
Species: Mumia flava Guanidine-I riboswitch
 RS: URS0000D7B6ED_488446
MFE: -47.387
Ligand: guanidine
Species: Burkholderia latens Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117502 URS00004AA15C_216591 URS0000AB6566_1348852 URS0000D7B6ED_488446
Length 119. 122. 122. 122.
Similarity - 0.976 0.976 0.976
Ensemble Norm 0.843 - - -
MFE -50.397 -47.287 -46.487 -47.387
Ligands - guanidine guanidine guanidine
Gene USP30 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 1. 1.
Length SE - 9. 9. 9.
Lev Distance - 20. 20. 20.
UBS 10. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 1. 1. 1.
H 3. 3. 3. 3.
BL 6. 6. 6. 6.
BR 4. 4. 4. 4.
UN 0.160 0.139 0.139 0.139

Sequences

Field Description
UTR seq + 25 gguuccgcugucucgggaaccgucguaucccucgguccggcggcggcggcggcgguagcggaggagacgguuucaggccuccggugcggcugcaATGAAGAACTGGGGAGTTATAGGTG
UTR dot + 25 …..(((((((.(.((.((((..(….)..)))))).).)))))))(((((.(((.((((((.((…..))…)))))).))).)))))…….((((….))))…….
RS 1 seq UCUUAGGGGUGCUAGGGUUCCGGUUCAUCGAGCGUCUGGUCCGAGAGCAGCCCGGCGCGGGUUCAUCCGUUCGCGAGACCGGAUGCGCACGCGCUACACGGCGGGACAAAAGCCCGGGAGAU
RS 1 dot …..(((.((((.(((..((((…………)))))))…)))).)))((((((.((.((((((.((….)).)))))).)).))))))……((((.(….)))))……
RS 2 seq UCUUAGGGGUGCUAGGGUUCCGGUUCAUCGAACGUCUGGUCCGAGAGCAGCCCGGUGCGGGUUCGUCCGAUCGCGAGACCGGACGCACACGCGCUACACGGCGGGACAAAAGCCCGGGAGAU
RS 2 dot …..(((.((((.(((..((((…………)))))))…)))).)))((((((.((.((((((.((….)).)))))).)).))))))……((((.(….)))))……
RS 3 seq UCUUAGGGGUGCUAGGGUUCCGGUUCAUCGAACGUCUGGUCCGAGAGCAGCCCGGCGCGGGUUCGUCCGAUCGCGAGACCGGAUGCACGCGUGCUACACGGCGGGACAAAAGCCCGGGAGAU
RS 3 dot …..(((.((((.(((..((((…………)))))))…)))).)))((((((.((.((((((.((….)).)))))).)).))))))……((((.(….)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table