Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117717 Similarity: 0.962 Similarity: 0.961 Similarity: 0.960
UTR: 5HSAA117717
Gene: USP45
MFE: -54.312
ENS: 0.981
Length: 133.
Predicted Ligands:
cobalamin - 7/20
molybdenum - 5/20
SAM - 4/20
 RS: URS0002327703_577650
MFE: -46.475
Ligand: cobalamin
Species: Desulfobulbus propionicus DSM 2032 Cobalamin riboswitch
 RS: URS0000AB800C_871968
MFE: -36.240
Ligand: molybdenum
Species: Desulfitobacterium metallireducens DSM 15288 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C05132_1536651
MFE: -39.957
Ligand: molybdenum
Species: Desulfosporosinus sp. Tol-M Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117717 URS0002327703_577650 URS0000AB800C_871968 URS0000C05132_1536651
Length 133. 133. 133. 132.
Similarity - 0.962 0.961 0.960
Ensemble Norm 0.981 - - -
MFE -54.312 -46.475 -36.240 -39.957
Ligands - cobalamin molybdenum molybdenum
Gene USP45 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 4.001 11.002
Length SE - 0. 0. 1.
Lev Distance - 47. 52. 49.
UBS 6. 9. 7. 7.
BS 1. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 0. 1. 0. 2.
H 4. 5. 4. 4.
BL 1. 1. 2. 1.
BR 2. 3. 2. 0.
UN 0.233 0.233 0.263 0.280

Sequences

Field Description
UTR seq + 25 ugggggcgggcgaacgaggccccaccucugccgggagcgggacgagcgcgcaggcgcagucuccccagguuguagacgcugcggcccggcccggcggguaaauaacagATGCGGGTGAAAGATCCAACTAAAG
UTR dot + 25 ..(((((………..)))))…(((((((((…(((((..((((….)))).))))).((.((((((((…)))))))).)))))))))))…………..((((…..))))……..
RS 1 seq CCUGGCGCAUCGGCGUGCGAGCCGUAUGCGGUCAAUCUUUCGGAGGAAACGGGUGCGAUUCCCGUGCUGUCCCGCAACUGUGAUUCCGCCGUCGGCGGACAAGCCAGAUACUCCUCGUGAACGCGGGUCUUCG
RS 1 dot ..((((((((((((……)))).))))).)))…….(((.(..(((((…….)))))..).)))(((….)))..((((((…))))))…………..(((((….)))))……
RS 2 seq CUAUAAUAAUUGUACCGAGCCUAGAGACCUACAGAGUUUCCAUGGUCCUAGGCCGUUUCAGGAUUCCUGAAACCGGGGUAUAUCUAGAAAUGGAUAGGCCUUCCAAAUGAAAAGGAGGAUUUAGAGCAUGGAG
RS 2 dot ……………….(((((.((((…………..)))))))))((((((((((…)))))))).)).((.((((((….)))))).))(((((………)))))……………
RS 3 seq AAUUAAUCCUAUCUCCGAGCCGGAUCAACCUAAUGAGUAAUCUAUGGUAACCGGCCAGGGCUUAAAGCCCUCGGGGUGUACCUGGAAACGGGUAUGCCUUCACUAUUGAAAAGGAGGUGACCAGGCCAGUUA
RS 3 dot …………….(.(((((….(((….((….))…)))..))))))((((((…)))))).((((((((((((….))))))))))))……………(((……)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table