Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117831 Similarity: 0.989 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA117831
Gene: USP6NL
MFE: -7.916
ENS: 0.768
Length: 68.
Predicted Ligands:
fluoride - 15/20
cobalamin - 2/20
homocysteine - 2/20
 RS: URS0000BECB54_755172
MFE: -9.009
Ligand: fluoride
Species: Peptoniphilus sp. RMA 16757 Fluoride riboswitch
 RS: URS0000DA04D3_1121390
MFE: -12.209
Ligand: fluoride
Species: Desulfacinum hydrothermale DSM 13146 Fluoride riboswitch
 RS: URS0002311A9C_12908
MFE: -12.787
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117831 URS0000BECB54_755172 URS0000DA04D3_1121390 URS0002311A9C_12908
Length 68. 69. 67. 67.
Similarity - 0.989 0.987 0.986
Ensemble Norm 0.768 - - -
MFE -7.916 -9.009 -12.209 -12.787
Ligands - fluoride fluoride cobalamin
Gene USP6NL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 3.001 3.013
Length SE - 1. 1. 1.
Lev Distance - 13. 15. 17.
UBS 4. 4. 3. 5.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 2.
ILR 2. 2. 1. 1.
H 1. 1. 1. 1.
BL 1. 2. 1. 1.
BR 1. 1. 1. 2.
UN 0.382 0.348 0.358 0.269

Sequences

Field Description
UTR seq + 25 acuauaaaauaauaaugaaaucuuggaauagauaaguuacucuATGAATTCAGACCAGGATGTAGCAC
UTR dot + 25 ……………….(((((((..(.(((..((……))..))).)..)))))))…….
RS 1 seq AAGAAAAUAGGGAAUGAAGUUCUCCCUUGGGCAACCUAAACCGCAACAGCUGAUGACUUCUACGAUUUU
RS 1 dot ……………((((((.((..(((.((……….))..)))..)).))))))………
RS 2 seq AAAACGAAAGGCAAUGAAGUCUGCCUGAAACGCCCUCACGUUCUGGGAUGAUGACUUCUACUCACGC
RS 2 dot ……………((((((..((((.((((……)))).))))…..))))))………
RS 3 seq UGUUGGGGAUCAAGGUGAAAUUCCAUGGCUCUACCAGGAACCGUAAAGUCGGAGUGCCAACCAGUAU
RS 3 dot ………….((((..(((((..((((.(((……..))).)))))))))..)).))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table