Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117895 Similarity: 0.905 Similarity: 0.905 Similarity: 0.904
UTR: 5HSAA117895
Gene: UTP15
MFE: -86.771
ENS: 0.759
Length: 280.
Predicted Ligands:
cobalamin - 19/20
FMN - 1/20

 RS: URS000232E8EB_1938441
MFE: -115.524
Ligand: cobalamin
Species: Burkholderia sp. Bk Cobalamin riboswitch
 RS: URS0002315FE8_760568
MFE: -93.034
Ligand: cobalamin
Species: Desulfotomaculum kuznetsovii DSM 6115 Cobalamin riboswitch
 RS: URS00023304CE_1849968
MFE: -49.672
Ligand: cobalamin
Species: Algibacter sp. SK-16 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117895 URS000232E8EB_1938441 URS0002315FE8_760568 URS00023304CE_1849968
Length 280. 281. 281. 283.
Similarity - 0.905 0.905 0.904
Ensemble Norm 0.759 - - -
MFE -86.771 -115.524 -93.034 -49.672
Ligands - cobalamin cobalamin cobalamin
Gene UTP15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 22.002 6. 4.006
Length SE - 1. 1. 9.
Lev Distance - 113. 123. 113.
UBS 17. 17. 18. 18.
BS 0. 2. 0. 0.
ILL 2. 5. 2. 2.
ILR 5. 7. 6. 4.
H 6. 6. 6. 7.
BL 6. 4. 8. 6.
BR 3. 2. 3. 4.
UN 0.086 0.046 0.075 0.166

Sequences

Field Description
UTR seq + 25 guacgucaucuucgcgcgacguucgguucgcugugugugucgccggcuccuugaggguccaugugauuuuuacgccagugcugcugaacugugcaggguagggagcuggcacaguccgauuaauuguccuugggucgaggugucucgucggacccuuuggggcucaguggagaauuaaggcagagucacuguaauuauuucuaauaccaauuccaaaauagugacucuuggacaauagugcaauuauauggaauuATGTTTGATGCACGAACGAGTGAGA
UTR dot + 25 ..(((((……….)))))(((((.(((((.(((((((((.(((((…..)))))…)))))….)))))))))..)))))(((((((.((……..)).)))))))((..((((((.((((((((((((((.((((….))))))))…))))))).))).)))))))).(((((((((((…………………….)))))))))))………(((((…(((((….)))))….)))))…………
RS 1 seq AAACUCGCACGCACUUCUGGUGCUCGUGUGCGCGCUCGUGCGCAUGCAGUUAAACGGGAAACAGGGCGCCCGCCUGUCACGAUUUGGGUCAACCUGUGCUGCCCCCGCAACGGUAAGCGAAAAGUGGCGUCACGGCGGUUCGCGUGGCGUCGCAGUGCCGGCUUCGAUGUCCACGCGCAAGGCCGCGUGGGCAUAUCACCACUGGGCGAGAAAUCACUCGUCCGGGAAGGGGAAGCGGCGCUUUCGCCAGCCCGGAUACCGGCCGGAACACGAAGGGCGAA
RS 1 dot …..((((((((((…)))))….)))))((((((((((…(((((……….(((((..(((((..(……)..)))).)..))))))))))…)))).))…))))….(((((((((((……..)))))))))))((((((.(((((.(((((((((((……)))))))))))..(.((.(((((((((……)))))))))…)))))))))))))).(((((…((((…….))))………))))).
RS 2 seq AAAUAUUAAACAUCAGCAGGUGCCCCCGUUUUUAACCGGGGGAGAAUAGGGAAUCAGGUGAAAAUCCUGAGCGGUCCCGCCACUGUGAUCGGGGAGCAACCUCCAAUGUUAUAAGCCACUGGCACGGCACUCACUGAUGAGCUGAUACAUGCAAUGGCACUUGUUUUAGCAAUGGAAAUGUAACAACAUGGUUUAACCAUAUCACUGGUGAGUGCUGGCUGGGAAGGCGGCUGGUUGUGAGGAUCCGGAGCCAGGAGACCUGCCUGCUGGUUCUUUCACCG
RS 2 dot ……….((((….))))((((((……..))))))……((((.(((((…….)))))….)))).((.(((….))))).((((((.((……….(((.(((((.((((((((((((.((((((((.((((((….)))..))).)))))………………………….))).)))))))))))))))))…)))))..))))))..((….((((((((.((……)).))))))))….)).
RS 3 seq ACAUUUGCAGCGAAUUUUGGUUUCGUUCAAUUUUAAUUGUUCGGAUUAAAAGGGAAUCAAGUGCAUUGACUUACGAUUUAUUUCAUUUAAAAAUAAUCGUAACUCUUUAAUUCUUGAGCUGUUCCCGCAACUGUAAGUUUAUGCUUAACAUAUUUAUUUGUAAAUAUUUAAUGUAAGUACUCUAUAGAGGAGGUGUUAUUAACUUCAAAACCACUGGUAAAUUACUGGGAAGGUGAAAUAACAUAAAACAAGCCAGGAGACCUGCCAAUAUUCAUCAUAUAAA
RS 3 dot ….(((.((((((…….)))))))))((((((((…..))))))))((((((((((……((.((((((.((((((…….)))))))))))).))…….)))))….)))))….((((((((…(((((((.(((((((….))))))))))).)))…))).)))))..(((((…….)))))…(((.((((((…))))))…)))……………..(.((((…)))).)……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table