Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117897 Similarity: 0.949 Similarity: 0.949 Similarity: 0.948
UTR: 5HSAA117897
Gene: UTP15_0
MFE: -40.149
ENS: 0.973
Length: 173.
Predicted Ligands:
cobalamin - 16/20
Mg2+ - 2/20
lysine - 2/20
 RS: URS0002317ADB_1487921
MFE: -38.092
Ligand: cobalamin
Species: Clostridium sp. HMP27 Cobalamin riboswitch
 RS: URS0002323420_1230730
MFE: -28.483
Ligand: cobalamin
Species: Tissierellia bacterium S5-A11 Cobalamin riboswitch
 RS: URS000231CB43_29367
MFE: -30.164
Ligand: cobalamin
Species: Clostridium puniceum Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117897 URS0002317ADB_1487921 URS0002323420_1230730 URS000231CB43_29367
Length 173. 172. 172. 173.
Similarity - 0.949 0.949 0.948
Ensemble Norm 0.973 - - -
MFE -40.149 -38.092 -28.483 -30.164
Ligands - cobalamin cobalamin cobalamin
Gene UTP15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.006 12.004 6.
Length SE - 1. 1. 0.
Lev Distance - 64. 63. 68.
UBS 8. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 3. 2. 3. 2.
H 4. 5. 4. 4.
BL 3. 3. 4. 4.
BR 1. 1. 2. 1.
UN 0.185 0.262 0.250 0.185

Sequences

Field Description
UTR seq + 25 gugugugucgccggcuccuugaggguccaugugauuuuuacgccagugcugcugaacugugcaggaauuaaggcagagucacuguaauuauuucuaauaccaauuccaaaauagugacucuuggacaauagugcaauuauauggaauuATGTTTGATGCACGAACGAGTGAGA
UTR dot + 25 (((((.(((((.(((((…..)))))…)))))…)))))…(.((((……..)))).)……..(((((((((((…………………….)))))))))))………(((((…(((((….)))))….)))))…………
RS 1 seq AUAUAAAACAUGUAAAAAGGUGCCCGAAAGGGAGAAUAGGGAAUGAGGUAUAAGCCUCAGCGGUCCCACCACUGUAAACGGUAGAACUUUUAUAAUCCACUGGAUUACACCGGGAAGGAAAAAGUAUCGUUAGUCCGUAAGCCAGGAGACCUGCCUUUUUCAUUAUUGCAUC
RS 1 dot ……..(((……..)))(((….)))……((((.((((((….))))))….))))………((((((…((((((….(((.((((……))))…)))))))))))))))…….(((.((((…)))).)))……………
RS 2 seq UGUAUCCAUAACUUAAUAGUUGUCUUAGGAAAAGGGAAAUUGGUGAAAAUCCAAUACAGCCCCCGCUACUGUAAUUGAGAUGAAAUCAACAAGAAAGUCACUGAGAAAUCGGGAAGACGUUGAAAGUAAAGUGAUCAUAAGUCAGGAGACCUACCUAUGGACAUUAAGUUAA
RS 2 dot ….(((((((((….))))))….)))…(((..(((((…….)))))….)))…………………..(((((……(((.((((….))))…))))))))……((((.(((((.((.(((…))))).))))).))))…….
RS 3 seq UUUAGGAUAGUGGGGUUUAGUAUAUUUUUUUAUACUAGAUUAAAAGGGAAACGAGUUAAAAUCUCGUACAGUGCCAUAGAGUGAGUAUUAAUAUGCCAUUGGGAAAAUGAGAAGGCAACACAGGCUAGACUAUGAAACCAAGUCAGGAUACCUGCUUAUAUAUUCAGUACAAU
RS 3 dot ………….(((((((((((……)))))))))))………(((((…….))))).(((((.((((………….)))).))))).(((.(((((………((((((.((((.((….))))))))….)))))))))…)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table