Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117907 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA117907
Gene: UTP18
MFE: -23.459
ENS: 0.998
Length: 74.
Predicted Ligands:
fluoride - 14/20
SAM - 3/20
homocysteine - 1/20
 RS: URS0000D91E36_36842
MFE: -13.125
Ligand: fluoride
Species: Clostridium halophilum Fluoride riboswitch
 RS: URS0000BEE6A8_741277
MFE: -18.843
Ligand: fluoride
Species: Fischerella sp. JSC-11 Fluoride riboswitch
 RS: URS0000BEA2B2_40318
MFE: -30.373
Ligand: fluoride
Species: Streptomyces nodosus Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117907 URS0000D91E36_36842 URS0000BEE6A8_741277 URS0000BEA2B2_40318
Length 74. 74. 75. 74.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.998 - - -
MFE -23.459 -13.125 -18.843 -30.373
Ligands - fluoride fluoride fluoride
Gene UTP18 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.022 7.002 9.002
Length SE - 0. 1. 0.
Lev Distance - 22. 21. 22.
UBS 5. 5. 4. 4.
BS 0. 0. 0. 1.
ILL 2. 2. 0. 1.
ILR 0. 2. 0. 2.
H 2. 2. 3. 2.
BL 1. 0. 0. 0.
BR 1. 1. 1. 0.
UN 0.068 0.216 0.107 0.108

Sequences

Field Description
UTR seq + 25 gcgcagcgagguuccacgugagcgccugcguuucuccucaaaccuaacgATGCCGCCGGAGCGGAGGAGACGAA
UTR dot + 25 ((((((.(..((((…..)))).))))))).((((((…………..((((….))))))))))….
RS 1 seq UUUAAGAUAGGGAAUGAAGUUCUCCCUGGAUUAAUAUUCCAAACCGCUGAUAAGCUAAUGACUUCUAAGCACCG
RS 1 dot .((((..((((((………))))))..))))………..(((…((((….).)))…)))….
RS 2 seq GAUGUUAAAGGUGAUGAAACUCACCUUCUGGCAUUUCCAGAGAACCGCCACUCGGCUAAUAGUUUCUAGCUCAAC
RS 2 dot ((((((((((((((……))))))).)))))))….(((……..)))(((((……..)))))….
RS 3 seq GGAGGGGGUGGCGAUGAGGCUCGCCGCAACCGCACGACCGGAGCACCGACCGUGCUGAUGGCCUCUCCCUGACG
RS 3 dot ((((((((((((((……)))))))..(((((((..(((….)))..)))))….)))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table