Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117910 Similarity: 0.972 Similarity: 0.970 Similarity: 0.966
UTR: 5HSAA117910
Gene: UTP23
MFE: -50.331
ENS: 0.827
Length: 126.
Predicted Ligands:
TPP - 5/20
glycine - 4/20
cobalamin - 4/20
 RS: URS0000C7B249_1470558
MFE: -50.081
Ligand: glycine
Species: Cupriavidus sp. SK-3 Glycine riboswitch
 RS: URS0000D782C1_1519565
MFE: -29.178
Ligand: TPP
Species: Fistulifera solaris TPP riboswitch (THI element)
 RS: URS0000D7CBD6_1519565
MFE: -31.531
Ligand: TPP
Species: Fistulifera solaris TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117910 URS0000C7B249_1470558 URS0000D782C1_1519565 URS0000D7CBD6_1519565
Length 126. 127. 127. 129.
Similarity - 0.972 0.970 0.966
Ensemble Norm 0.827 - - -
MFE -50.331 -50.081 -29.178 -31.531
Ligands - glycine TPP TPP
Gene UTP23 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.009 10.018 7.008
Length SE - 1. 1. 9.
Lev Distance - 34. 34. 31.
UBS 9. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 2.
ILR 1. 1. 3. 3.
H 1. 1. 2. 1.
BL 5. 6. 4. 4.
BR 5. 6. 5. 5.
UN 0.159 0.252 0.024 0.070

Sequences

Field Description
UTR seq + 25 gcuucauuuccgggugaaacuggcauugaggguacuggggcgugcgugaggcguuuacugaugcuuccugguccgguggccucggucccgguaagccaggcATGAAGATCACAAGGCAGAAACATG
UTR dot + 25 .((((((..((.(((…(((((.(((((((.(((((((.((…(.((((((((….))))))))))).))))))).))))))).)))))..))).)).))))))……………….
RS 1 seq ACCGAUAAAACUGGAGAGCGCCGGACCGGACCACCAAGCGUGGCGCGGCAUGCGGCCGCCGAAGGGGCAAGCCGGCACCCGUGGUGGGUGCGGCGAAUCUCUCAGGCAAAAGGACAGUGGGGGCAGA
RS 1 dot ……….(((((((.(((((.(((..(((((…(.((.((.((((.(((..((……)).))).))))))))).))))).))).)))))..)))).)))………………….
RS 2 seq UACUUCUGCCGCGGGAGCUUUGUGAUGUGGGUAAUGGCUGAGAAAUGAAAGAGUCGAAAGAUUCUUUGUUGACCGUUCGAACCUGAACAUGGUAAUGCAUGCGAAAGGGAAGGUGAGAUGUGUCAUG
RS 2 dot ..(((((..((((…((.((((.(((((((((((((.(((.(…..(((((((….)))))))).))).)))))…))))..)))).)))).)).))))….)))))((((……)))).
RS 3 seq CACUUUUGCCGCGGGAGCUUUGUGAUGUGGGUAAUGGCUGAGAAAUUAAUGGAGUCGAAAGAUUCUUUGUUGACCGUUCGAACCUGAACAUGGUAAUGCAUGCGAAAGGGAAGGCAAAAGUAUUAUGAA
RS 3 dot .((((((((((((…((.((((.(((((((((((((.(((.((……((((((….)))))))).))).)))))…))))..)))).)))).)).)))………)))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table