Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117917 Similarity: 0.976 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA117917
Gene: UTP6
MFE: -34.440
ENS: 0.896
Length: 108.
Predicted Ligands:
TPP - 5/20
guanidine - 4/20
homocysteine - 3/20
 RS: URS0000D693E3_12908
MFE: -40.406
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000AB3A84_631362
MFE: -35.096
Ligand: homocysteine
Species: Thiorhodovibrio sp. 970 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000DA667B_302980
MFE: -34.138
Ligand: guanidine
Species: Paenibacillus sp. MY03 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117917 URS0000D693E3_12908 URS0000AB3A84_631362 URS0000DA667B_302980
Length 108. 107. 108. 108.
Similarity - 0.976 0.976 0.975
Ensemble Norm 0.896 - - -
MFE -34.440 -40.406 -35.096 -34.138
Ligands - GMP homocysteine guanidine
Gene UTP6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.004 6.007 5.025
Length SE - 1. 0. 0.
Lev Distance - 31. 30. 31.
UBS 10. 10. 9. 11.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 2. 2. 2. 1.
H 2. 2. 2. 2.
BL 4. 5. 3. 5.
BR 5. 5. 3. 6.
UN 0.019 0.084 0.102 0.176

Sequences

Field Description
UTR seq + 25 gggucuccgaaccugaaaccgggagcuuccugcucguguucgcuguugagaagcuacccgcgggguuguagaccucggaccucATGGCAGAGATAATTCAGGAACGCA
UTR dot + 25 ((((((.(((.((((….(((((((((((.((.((….))..)).).)))))).)))))))).))).))))))((..(((……………..)))..))..
RS 1 seq GCUCCUACGGAACGUGAUGAUCCGGAUGGUCCGCCUCUCCCGCAGAGGCGAACUCGGCCGCCUAAUGGCCAUCCGGGGAGCGAGUGGCGAGACCGGUCCGUUCUGAC
RS 1 dot ((((((.((((..((.((….(((.((((.(((((((…..))))))).)).)).)))….)).))..))))))))))((.(((…..))).))………
RS 2 seq CCUUCCGAGGAGCGCUGCAACCCACCCUGGAUUCUCAAAUGGAUCAUCAAGGGCAAGGGCCAGGCUCGGAAGCUGGAGCCCCAACAAUUACAACGGCGCUCACUCACG
RS 2 dot .(((((…((((.(((…(((.((((((((((……)))))..)).)))…))).))))))))))))…((((.((…………)).))))…….
RS 3 seq GCAAAGGGAUUCUAGGGUUCCGCGGCGCUCGCGCCGGACUGGUCCGAGGGAAUCCGCGCGAUAGCCGUUCUAUUGCGAAUGACACGGAGGGACAAAAGCCCGGGAGAU
RS 3 dot ((((.(((((….((.(((((((((.((((.(((…..))).)))).)…))))).)).).))))))).))))…………(((.(….))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table