Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA117984 Similarity: 0.986 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA117984
Gene: VAMP4
MFE: -14.299
ENS: 0.706
Length: 74.
Predicted Ligands:
cobalamin - 7/20
fluoride - 7/20
aminoglycoside - 2/20
RS: URS0002335348_1736486
MFE: -31.750
Ligand: cobalamin
Species: Kitasatospora sp. Root187 AdoCbl variant RNA
RS: URS0002332307_1618464
MFE: -16.
Ligand: cobalamin
Species: Candidatus Levybacteria bacterium GW2011_GWB1_39_7 AdoCbl variant RNA
RS: URS0000C4DC95_1609975
MFE: -11.398
Ligand: fluoride
Species: Clostridium sp. FS41 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA117984 URS0002335348_1736486 URS0002332307_1618464 URS0000C4DC95_1609975
Length 74. 74. 73. 74.
Similarity - 0.986 0.984 0.983
Ensemble Norm 0.706 - - -
MFE -14.299 -31.750 -16. -11.398
Ligands - cobalamin cobalamin fluoride
Gene VAMP4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 3. 6.003
Length SE - 0. 1. 0.
Lev Distance - 18. 20. 21.
UBS 6. 7. 6. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 2.
ILR 2. 2. 1. 3.
H 1. 1. 1. 1.
BL 3. 3. 3. 1.
BR 2. 3. 3. 2.
UN 0.014 0. 0. 0.068

Sequences

Field Description
UTR seq + 25 guggugacuauccuguugagaagcaaaagauacuuugcaaguaaaaaauATGCCTCCCAAGTTTAAGCGCCACC
UTR dot + 25 ((((((.((……(((.((.(((…..(((((…)))))…….))).)).)))…..)))))))).
RS 1 seq UCCUCGUGCGGGGGAAGCCGGUGCGACUCCGGCGCUGACCACGCAACCGUCACAGUCGGGAUGCCCGCCGGGGA
RS 1 dot ((((((.(((((.(…((((((.(((….(((…….)))….))).)).))))..).)))))))))))
RS 2 seq AAUAUAUAUUGGAAAUCGCCGUGAAAGUCGGCGGAACUGCCGGUACUGUUAUAUCCAGAAAACAAUAUAUAUU
RS 2 dot (((((((((((((.((.((.(((….((((((….))))))))).)).)).))))…….)))))))))
RS 3 seq CGUGAGUAUGGGAAUGAGGUUCUCCCUUAGUGAAUACUAAAACCGCUUAUCAAGCUGAUGACUUCUGCGUAAAU
RS 3 dot (((((((((.((..(((((((…..(((((….)))))))))…..)))..)).))).)))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table