Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA118051 Similarity: 0.985 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA118051
Gene: VAT1
MFE: -14.552
ENS: 0.839
Length: 64.
Predicted Ligands:
fluoride - 13/20
unknown - 5/20
cobalamin - 2/20
 RS: URS0000D9AF11_1797812
MFE: -20.336
Ligand: fluoride
Species: Deltaproteobacteria bacterium GWA2_65_63 Fluoride riboswitch
 RS: URS0000DB0620_1801964
MFE: -18.921
Ligand: fluoride
Species: Planctomycetes bacterium RBG_13_62_9 Fluoride riboswitch
 RS: URS0000E604EE_413882
MFE: -23.841
Ligand: unknown
Species: [Polyangium] brachysporum nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA118051 URS0000D9AF11_1797812 URS0000DB0620_1801964 URS0000E604EE_413882
Length 64. 65. 63. 65.
Similarity - 0.985 0.984 0.984
Ensemble Norm 0.839 - - -
MFE -14.552 -20.336 -18.921 -23.841
Ligands - fluoride fluoride unknown
Gene VAT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 4.001 3.
Length SE - 1. 1. 1.
Lev Distance - 16. 19. 20.
UBS 7. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 1. 2. 0. 1.
H 2. 2. 2. 2.
BL 3. 2. 4. 3.
BR 4. 2. 3. 3.
UN 0.078 0.108 0.111 0.077

Sequences

Field Description
UTR seq + 25 uguggucugugacuaugagugacggcaggagaccgggugATGTCCGACGAGAGAGAGGTAGCCG
UTR dot + 25 …(((((((.(((…))).))……))))).(((.((.(((…….).)).)).))).
RS 1 seq ACGCGUGAAGGGGAUGGAGUCCCCCUCAUAAUCGCCUACGCCCGGCUGAUGACUCCUACCGCGCA
RS 1 dot ..((((((.((((((…)))))).)))….)))….((.(((..(…….)..))).)).
RS 2 seq ACUGAUCGUGGGGAUGGAGUCCCCCGGACAACCGCCUGCAGGGCUGAUGACUCCUACCGGUUU
RS 2 dot ..((.(((.((((((…))))))))).))…(((.(.((((……..)))).).)))..
RS 3 seq GGGUGUCGGGCGGGACUUGCUUCUUGUUGCCCCCGGCAGGUUGACGCGAUGGUCGGGCCGCCACG
RS 3 dot ((((..((((.((……)).))))..))))..(((.(.(((((……))))).).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table