Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA118124 Similarity: 0.964 Similarity: 0.962 Similarity: 0.961
UTR: 5HSAA118124
Gene: VDAC1
MFE: -33.798
ENS: 0.805
Length: 151.
Predicted Ligands:
FMN - 12/20
glucosamine - 7/20
cobalamin - 1/20
 RS: URS0000BF4A07_1262826
MFE: -30.613
Ligand: glucosamine
Species: Clostridium sp. CAG:594 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C5B08D_1536775
MFE: -41.621
Ligand: FMN
Species: Paenibacillus sp. FSL H7-0737 FMN riboswitch (RFN element)
 RS: URS0000C6DB46_1619097
MFE: -33.717
Ligand: glucosamine
Species: candidate division WS6 bacterium GW2011_GWF1_35_23 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA118124 URS0000BF4A07_1262826 URS0000C5B08D_1536775 URS0000C6DB46_1619097
Length 151. 150. 149. 150.
Similarity - 0.964 0.962 0.961
Ensemble Norm 0.805 - - -
MFE -33.798 -30.613 -41.621 -33.717
Ligands - glucosamine FMN glucosamine
Gene VDAC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 15.004 10.004
Length SE - 1. 4. 1.
Lev Distance - 44. 40. 48.
UBS 8. 8. 10. 8.
BS 0. 0. 0. 0.
ILL 3. 1. 2. 1.
ILR 2. 1. 2. 1.
H 4. 4. 4. 4.
BL 1. 3. 4. 2.
BR 0. 1. 1. 2.
UN 0.232 0.247 0.168 0.293

Sequences

Field Description
UTR seq + 25 cugugaaaauccuacgagccauuuuggcaauaaauuuguacaaguucuuuaaaacugugcagaccucugauccagcaccuccuugcugccuagaaaauaaucgcagauacgugcaaaaagcagaagATGGCTGTGCCACCCACGTATGCCG
UTR dot + 25 ……………..((((…))))……(((((((.((((……)))))))))))..((((…(((((……)))))..))))……..(((..((((((……((((…….))))……)))))))))..
RS 1 seq CUUAUUUAUUUAGCGCCAGGCCCAAAAGAGGGUGACGAGGACUAUGGUUAUCGAAAGAUUCGGCGGAUGCCAUAGCGGAUUUGUGAAUCGUAAGAAAUACUUUUAAAAGAUAAAAUUGAAAUUAUAACAAAGAAGUAUUUCACACAGUUA
RS 1 dot ……………….((((……))))..(((.(((….))).)))…(((((.((((((.((…..)))))))))))))….(((((((((((…..((((……..))))…..)))))))))))………
RS 2 seq CAAGAUUCUCGGGGUAGGGUGAAAUUCCCAACCGGCGGUAAUGUUCAAAGCGAACUGAGCCCGCGACUCACUUGUUCUGCUUGCAGAGAAGUGACUGAUCUGGUGUGAAUCCAGAGCCGACGGUAAAGUCCGGAUGGGAGAGGAUCAUA
RS 2 dot …………(((.(((…….))).))).((((….(((((……..)))))))))…((((((.(((((….)))))))))))………((((.((((….(((.(((……)))..)))….))))))))
RS 3 seq CUUAAUUUAAAAGCGACUGGGCAUAUAUUGCUACGAGGAAGGAGUAAUUCGGAUAAUCAGCGGGUACUCCUAGGUUCCGUUAUGAACCUUAAGAUUAAUCAAUGUGUGGGGUAUUUGGAUACACCGGCAAACAGAUUGCCAAUGACUUAG
RS 3 dot ……………….((((…..))))…….((((((.(((((………)))))))))))((((((……))))))……(((((….(((.((((((….)))).)).)))….)))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table