Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA118367 Similarity: 0.989 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA118367
Gene: VPS25
MFE: -23.255
ENS: 0.930
Length: 65.
Predicted Ligands:
fluoride - 15/20
cobalamin - 4/20
zmp-ztp - 1/20
 RS: URS0000DB4F6B_1703929
MFE: -24.595
Ligand: fluoride
Species: Streptomyces sp. CB01249 Fluoride riboswitch
 RS: URS0000D790E4_392015
MFE: -15.832
Ligand: fluoride
Species: Alicyclobacillus macrosporangiidus Fluoride riboswitch
 RS: URS0000C67067_1470557
MFE: -29.496
Ligand: fluoride
Species: Streptomyces sp. Tu 6176 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA118367 URS0000DB4F6B_1703929 URS0000D790E4_392015 URS0000C67067_1470557
Length 65. 65. 64. 67.
Similarity - 0.989 0.987 0.986
Ensemble Norm 0.930 - - -
MFE -23.255 -24.595 -15.832 -29.496
Ligands - fluoride fluoride fluoride
Gene VPS25 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16. 7. 7.
Length SE - 0. 1. 4.
Lev Distance - 10. 14. 12.
UBS 5. 3. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 0. 0.
H 2. 2. 2. 2.
BL 3. 0. 1. 1.
BR 1. 0. 2. 2.
UN 0.215 0.231 0.234 0.209

Sequences

Field Description
UTR seq + 25 guccuuagccgguagcuuccggguuuccugggcuacuacgATGGCGATGAGTTTCGAGTGGCCGT
UTR dot + 25 ……(.((((……)))).)……(((((((.(((.(((…..)))))))))))))..
RS 1 seq AUGCGUACCGGUGAUGGGGCUCACCGAAACCGCGGCCGAUGGCCGCUGACGGUCCCUGGUUGUUU
RS 1 dot ……..((((((……))))))…..(((((((..(((((….)))))..)))))))..
RS 2 seq AUCGAAUCCGGUGAUGGAGCUCACCGUAUAAAUGCCCAUUGAGGAUGAUGGCUCCUGUGCAUCU
RS 2 dot ……..((((((……))))))…..((((.((..(((……..))).)).))))..
RS 3 seq ACGUGCCGGGGCGAUGGGGCUCGCCCGUGACCGCACGGACCGCCGUGCUGAUGGCCUCUGCGUGGAC
RS 3 dot ……..((((((……))))))….((((.((((..(((((….))))).)))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table