Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA118403 Similarity: 0.965 Similarity: 0.964 Similarity: 0.962
UTR: 5HSAA118403
Gene: VPS33A
MFE: -66.275
ENS: 0.982
Length: 138.
Predicted Ligands:
SAM - 8/20
FMN - 4/20
Mn2+ - 3/20
 RS: URS0000C0EC8B_1129367
MFE: -35.983
Ligand: TPP
Species: Pseudoalteromonas luteoviolacea S4054 TPP riboswitch (THI element)
 RS: URS0000C154DF_1616788
MFE: -40.089
Ligand: SAM
Species: Paenibacillus bovis SAM riboswitch (S box leader)
 RS: URS0000C835EB_915437
MFE: -43.589
Ligand: SAM
Species: Saccharibacillus sacchari DSM 19268 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA118403 URS0000C0EC8B_1129367 URS0000C154DF_1616788 URS0000C835EB_915437
Length 138. 139. 137. 138.
Similarity - 0.965 0.964 0.962
Ensemble Norm 0.982 - - -
MFE -66.275 -35.983 -40.089 -43.589
Ligands - TPP SAM SAM
Gene VPS33A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.002 10.011 24.010
Length SE - 1. 1. 0.
Lev Distance - 42. 43. 41.
UBS 9. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 0. 2. 2. 3.
ILR 0. 1. 2. 3.
H 4. 4. 3. 3.
BL 2. 3. 2. 2.
BR 4. 5. 4. 2.
UN 0.080 0.129 0.182 0.181

Sequences

Field Description
UTR seq + 25 gugcgcugccguaccggucacguggacguuuggucacgugacugcguccgugguccucccguaggaaccggcggacucgguuggcguuguggggcagggggugguggagcaagATGGCGGCTCATCTGTCCTACGGCC
UTR dot + 25 (((((….)))))(((((((((.(((…..)))))))))))).((((((((((((…..)))).))).)))))………(((((((((((((((((.((………..)).)))).))))))))))))).
RS 1 seq CCCGCUUCCUAGGGGAGCCCAAUGUACUAAGGCUGAGAUUCUACUAACGGAGUGUUUACUGCACUCUUGUUGUUAAAAGUAGUAACCCUUUGAACCUGAUAAAGUUAAUGCUUGCGCAGGGAAGGAGGUAGCCACUGGU
RS 1 dot (((.((….)))))((((………..))))……….(((((((((((…..))))))).))))…..(((.((.(((((((…((((…((((….))))…)))).)))).))).)).)))…
RS 2 seq AUCUUAUCAAGAGCAGGUGGAGGGACUAGCCCUAUGAAGCCCGGCAACCGGCGGUCAUAUACCGUACGGUGCUAAUUCUAGCAGAGAUACAGGUACAUCCUACGAUGAAGUAUCUGGUAUCUGCUGACAGAUGAGAG
RS 2 dot ……………(((..((((…..))))…..))).(((.(((((((((…..))))).)))))))…(((..(((((((((((((((.((…….)).))))))).))))).)))..)))……
RS 3 seq AUCUUAUCAAGAGCAGGCGGAGGGAAAAGCCCGAUGAAGCCCGGCAACCGACCCUUUACGGGGCACGGUGCUAAUUCUUGCUCGUUCAUUCGAAUCCUGCUUAUUUUUUGCGCGGACGAAUGAACGGAGAGAUAAGAA
RS 3 dot ……………((((..(((…..)))..)…))).(((.((((.((((….))))..)))))))…((((..(((((((((((..((((((………))).)))))))))))))).))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table