Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA118620 Similarity: 0.969 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA118620
Gene: VRK1
MFE: -49.818
ENS: 0.996
Length: 131.
Predicted Ligands:
TPP - 12/20
cobalamin - 6/20
glycine - 1/20
 RS: URS000232D4FC_1073325
MFE: -21.435
Ligand: cobalamin
Species: Salegentibacter sp. HD4 Cobalamin riboswitch
 RS: URS000232A66B_262209
MFE: -50.230
Ligand: cobalamin
Species: Janibacter melonis Cobalamin riboswitch
 RS: URS0000AB9E95_12908
MFE: -27.944
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA118620 URS000232D4FC_1073325 URS000232A66B_262209 URS0000AB9E95_12908
Length 131. 131. 130. 131.
Similarity - 0.969 0.967 0.966
Ensemble Norm 0.996 - - -
MFE -49.818 -21.435 -50.230 -27.944
Ligands - cobalamin cobalamin cobalamin
Gene VRK1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 7.001 7.001
Length SE - 0. 1. 0.
Lev Distance - 38. 40. 43.
UBS 9. 9. 10. 8.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 3.
ILR 5. 3. 4. 4.
H 2. 2. 2. 2.
BL 2. 3. 2. 2.
BR 0. 2. 2. 2.
UN 0.092 0.107 0.115 0.115

Sequences

Field Description
UTR seq + 25 acugcagggugcgaaggggccggcgccgcugccgaguuacgagucggcgaaagcggcgggaaguucguacugggcagaacgcgacgggucugcggcuuaggugaaaATGCCTCGTGTAAAAGCAGCTCAAG
UTR dot + 25 .((((..((((((((….((..((((((((((((……..)))))…)))))))))…))))))))..))))……..(((.((((.((..((((……))))…))….)))))))…
RS 1 seq UUUAGUAACCAAGCUUAAUAUUUUGGUUUCCAGAUAGAAAACAAGGGGAAUCACGUGAAAAUCGUGAGCUGUUGCGCAACUGUAAGUAUGUAAAUACAAGCCAGGCUACCUUUCUUUAUUGAUAGACUUUU
RS 1 dot ….(((((..((((((..((((((((((((…………..))))))))…..))))..)))))))))))……..((((.(((.((((.(((..(((…)))..))))))).))).))))..
RS 2 seq CUUCGUGGUUGUGAGAGGAUCGCGCCCGGCGCAGCCAACCGAGGAAUCCGGUGCGAAUCCGGAGCGGUCCCGCCACUGUCACGGCCCCCUGGGGCCCGAGCCAGACACUCGGUCUGCACCCGUCACCGUC
RS 2 dot ..((((((..(((.(.(((((((..(((((((…..((((…….)))))))…)))).))))))))..)))..))))))…..(((((((((((…….)))))…)).))))……..
RS 3 seq GUACUGAAACGCAUGGUGGGGAAUAAAUGUGAAAUUCAUUUGCUGUUCCUGCAACCGUAAAGUCGGAGCGCCACCCAGUAUAGUCCGCUGUUGAACGAAGGCCAGGAAAAGUCUAGUUCUGCAAUUAAAUU
RS 3 dot ((((((…((((((((.(((((((…((((…))))….)))))))…)))))………)))…..))))))…….(((.((((..((((……..)))).)))).)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table