Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA118621 Similarity: 0.959 Similarity: 0.952 Similarity: 0.952
UTR: 5HSAA118621
Gene: VRK1_0
MFE: -66.859
ENS: 0.717
Length: 174.
Predicted Ligands:
cobalamin - 14/20
FMN - 3/20
lysine - 1/20
RS: URS000231702C_1801714
MFE: -53.719
Ligand: cobalamin
Species: Nitrospirae bacterium RIFCSPHIGHO2_02_FULL_42_12 Cobalamin riboswitch
RS: URS00023286A7_1603606
MFE: -61.667
Ligand: cobalamin
Species: Desulfuromonas soudanensis Cobalamin riboswitch
RS: URS0002316364_1797576
MFE: -49.542
Ligand: cobalamin
Species: Caldithrix sp. RBG_13_44_9 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA118621 URS000231702C_1801714 URS00023286A7_1603606 URS0002316364_1797576
Length 174. 174. 174. 173.
Similarity - 0.959 0.952 0.952
Ensemble Norm 0.717 - - -
MFE -66.859 -53.719 -61.667 -49.542
Ligands - cobalamin cobalamin cobalamin
Gene VRK1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 14.015 9.
Length SE - 0. 0. 1.
Lev Distance - 52. 56. 58.
UBS 16. 14. 14. 14.
BS 0. 0. 0. 0.
ILL 4. 4. 6. 3.
ILR 6. 5. 5. 5.
H 3. 3. 3. 4.
BL 7. 7. 5. 6.
BR 4. 4. 3. 3.
UN 0.029 0.069 0.149 0.035

Sequences

Field Description
UTR seq + 25 cccgccccuccucgucgccuccgagccaaugggaaggcuccauacugcagggugcgaaggggccggcgccgcugccgaguuacgagucggcgaaagcggcgggaaguucguacugggcagaacgcgacgggucugcggcuuaggugaaaATGCCTCGTGTAAAAGCAGCTCAAG
UTR dot + 25 ((.((((((..((((..(((.((((((……..)))))……).)))..)))))))))).))(((..(((((.((.(((((((((.((….)).)))….)))))))).)))))…)))..(((.((((.((..((((……))))…))….)))))))…
RS 1 seq CUUUAUAUGUGAUUUACAGGUAACGGGAAGGGGGUGCGAGUCCCCCACGGUGCCGCCACUGUAAUCGGGGAGUAAGGCUGGAUUAAUGCCACUGGGAUAUGAAUCCUAUCCCGGGAAGGCCCGGCCAAACAAUGAUCCGUAAGUCAGGAAACCUGCCUGUCAGUCAUUCUUACC
RS 1 dot ..((((.(.(((.((((((….(((.(.(((((…….)))))….).)))…))))))))).)..))))((((((……(((.((((((((…….))))))))…)))))))))….((((((..(..((.((((…)))).))..).))))))……
RS 2 seq UAAAAUUUAACGUUUUCAGGCGCAGGAAAGGGGGUGGAAAACCCCCGCGGACCCGCCGCUGUAACGGAGGACCGACCCCUCGCAGACCCACUGGACGGACAUCGAGCCGUGCGGGAAGGGGAGGGGGAGGGAUGAUCCCGGAGCCAGAAAGCCUGCCUGGAAAAUGAACUUGUU
RS 2 dot …..(((..((((..(((..((.((…((((((…..))))))…..)).))..))).))))..)))((..((((((…..(((.(((.((((……..)))).)))…)))))))))..))…….((((.(.(((…..))))))))…………..
RS 3 seq AUCUUUUUUCAUUAUUCUGGUAUCGGGAAGCGCGGUGAAAUGCCGCCACUGCCCCGCAACUGUAAUGGAGAACCAAAACUCAGCAUGCCACUGUCCCAAAACGGAUGGGAUGGGAAGGCGAGUUAGUAGGAUGAUCCCAGAGUCAGGAUACCGGCCAGGAUAGAGUGAACCCG
RS 3 dot ….(((((((((((…(((..((((.((.(((((…..)))))..))..))))..))))))))))))))((…(((.(((.((((.((((((((…….))))))))…)))).)))))).))..(((((……..)))).)(((.((……..))…)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table