Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119059 Similarity: 0.953 Similarity: 0.950 Similarity: 0.947
UTR: 5HSAA119059
Gene: WBP11
MFE: -31.378
ENS: 0.971
Length: 174.
Predicted Ligands:
lysine - 10/20
Mg2+ - 5/20
cobalamin - 4/20
 RS: URS0000D7F163_29349
MFE: -37.239
Ligand: Mg2+
Species: Clostridium thermoalcaliphilum M-box riboswitch (ykoK leader)
 RS: URS0000DAD0E0_185008
MFE: -39.764
Ligand: lysine
Species: Butyrivibrio hungatei Lysine riboswitch
 RS: URS0000B7A699_1234679
MFE: -44.563
Ligand: Mg2+
Species: Carnobacterium maltaromaticum LMA28 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119059 URS0000D7F163_29349 URS0000DAD0E0_185008 URS0000B7A699_1234679
Length 174. 172. 173. 174.
Similarity - 0.953 0.950 0.947
Ensemble Norm 0.971 - - -
MFE -31.378 -37.239 -39.764 -44.563
Ligands - Mg2+ lysine Mg2+
Gene WBP11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7. 6.
Length SE - 4. 1. 0.
Lev Distance - 57. 64. 69.
UBS 9. 10. 9. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 3.
ILR 1. 2. 2. 2.
H 6. 6. 4. 6.
BL 1. 2. 1. 1.
BR 1. 1. 2. 1.
UN 0.195 0.157 0.208 0.190

Sequences

Field Description
UTR seq + 25 guaauuuaucuuuucuugaaaauuguuuuuaucuggguguucguaucauuaguauagcuaucucauccugcaccucugccaaguaguggguagcaaucauaucuaguacuuuauagugcuacguaguaaacauuuacugaauuuuguugATGGGACGGAGATCTACATCATCCA
UTR dot + 25 .((((((.((…….))))))))………((((((………((((…))))………))))))(((((……..)))))……….(((((((….)))))))..((((((….))))))……..((((((((……))).)))))….
RS 1 seq AAUACAACUUGUUAGGUGAGGCUCCUAAAUGAACACAGGCUAUUGCCCAAAAACGUCGAGAGACGCCAAUGGGUAGAACAGGCAAGAUCGGAUUAAGGUCUGCUUAAUAUAGCUGAAUCAAUAAAUUGAUUCUACGUCAUUUAGUGCUAAAUCCAAAACUAGGAGUUAAAGU
RS 1 dot …….(((((((((…….))))…….)))))…(((((((….((((….))))….)))))))…((((.(((((…….)))))))))………(((((((….)))))))(((……..))).(((.(((…….))).)))….
RS 2 seq ACAAGAGAUAGAGGUUGCGUAAUUCAAUGAGUAAUUCUGCAGAUGUGUCAGGCACAGGAGAAGCAGAACAAAAGGUGAAUACGCCGAAAGGCUUAGUACCUGUAUGCUAAGUACUUGGGCAUAAAGUAAAUAGCUUUAUGACUGUCAUCGCAAGAUGGGGCGCUAUCAACAGC
RS 2 dot …………….((((.(((((……..((((((…(((((…)))))……))))))…….)))))))))…(((((((((((……)))))))).))).((((((((((…..)))))))).))……….(((((….)))))……
RS 3 seq AGUGUUACCAGUUAGGUGAGGCUCCUAUGCAAAUAUAGGCCAUUGCCCAAAAACAUCGAAAGAUGCCAAUGGGUAGAACAGGGAUUGUCGGAUUAAGGCUUUCCAUAAGAUGGCUAAAAGUAGAAUGAUACUUUUUACGUUGCAUAGUGCUAAAACUCGACGAGUGGUAGAUUU
RS 3 dot (((.(((((…..))))).)))((((((….))))))…(((((((….((((….))))….)))))))…..(((..(((…….)))..)))………..(((((((……)))))))..(((((…(((……))))))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table