Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA119200 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA119200
Gene: WDR20
MFE: -26.404
ENS: 0.805
Length: 89.
Predicted Ligands:
TPP - 9/20
glycine - 6/20
homocysteine - 1/20
 RS: URS0000100561_862719
MFE: -29.639
Ligand: TPP
Species: Azospirillum lipoferum 4B TPP
 RS: URS0000AB514E_1005058
MFE: -16.104
Ligand: TPP
Species: Gallibacterium anatis UMN179 TPP riboswitch (THI element)
 RS: URS00005EC40A_1288971
MFE: -23.625
Ligand: glycine
Species: [Clostridium] ultunense Esp Glycine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA119200 URS0000100561_862719 URS0000AB514E_1005058 URS00005EC40A_1288971
Length 89. 88. 89. 89.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.805 - - -
MFE -26.404 -29.639 -16.104 -23.625
Ligands - TPP TPP glycine
Gene WDR20 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 8.001 3.003
Length SE - 1. 0. 0.
Lev Distance - 23. 24. 26.
UBS 6. 5. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 3. 2. 1. 3.
H 2. 2. 3. 1.
BL 1. 0. 2. 1.
BR 1. 1. 1. 2.
UN 0.157 0.182 0.124 0.101

Sequences

Field Description
UTR seq + 25 gaacagcgccugcgcggugggcgugauccgggcacuuagggcaggaugaacgcugcuuuccaagATGGCGACGGAGGGAGGAGGGAAGG
UTR dot + 25 …((((((((((.(((((..((…..))..))))..).)))))…..)))))((((((………..))))))………..
RS 1 seq GUCAUAGGCCUGGGGUGCCGUGCGGUGGUCGCGCGGCUGAGAACACACCCAUCGAACCUGUCUGGGUAAUUCCAGCGAAGGGAGCCGC
RS 1 dot …(((((..((((((((((((((…..))))))))…….)).))))…..)))))(((((….)))))………….
RS 2 seq UCGAAUUAGUCGGGGUGCUUUAUGGCUGAGAACAUACCCGAGAACCUGAUCCAGUUAAUGCUGACGUAGGAAACUAAUACGAAAUUUCU
RS 2 dot ..(.(((((((((((((.(((……..)))))).)))))….))))))((((….)))).((((………))))……..
RS 3 seq CAUCUCUGGAGAGUGCUUCCGCAGGAAGCCACCAAAGGAGGAACUCCGAUAGGGAGGAUACUCUCAGGUAAAGGGACAGGGGACAGGAU
RS 3 dot ..((((((((((((((((((…(((..((.((…)).))…)))…..))))).)))))))………..))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table